Research Article
Contribution of the Infection-Associated Complement Regulator-Acquiring Surface Protein 4 (ErpC) to Complement Resistance of Borrelia burgdorferi
Table 1
Oligonucleotides used in this study.
| Oligonucleotide | Sequence (5′–3′) | Use in this work |
| ErpC 5nc(+) | GTTGTATGTGTTTTGAAGCTTTTAGTAATGAGCAGGGC | Cloning in pKFSS1 and amplification of erpC | HindIII | ErpC 3nc(−) | CGATCTCTCCTGTATTTTAAGCTTCTATTTTAAATTTTTCTTAAG | Cloning in pKFSS1 and amplification of of erpC | HindIII | aadA + NdeI | CATATGAGGGAAGCGGTGATC | Amplification of aadA gene | aadR + AatII | GACGTCATTATTTGCCGACTACC | Amplification of aadA gene | Fla6 | AACACACCAGCATCGCTTTCAGGGTCT | Amplification of flaB gene | Fla7 | TATAGATTCAAGTCTATTTTGGAAAGCACCTA | Amplification of flaB gene |
|
|
Sequences of specific restriction endonuclease recognition sites are underlined.
|