Table 1: Primer sequences and PCR conditions.

GenePrimer sequences (5′ to 3′)Annealing temperature (°C)PCR cycles

AML-1SenseACAAGGCAGATCCAACCATC6333
AntisenseGTCGGGGAGTAGGTGAAGG

c-MybSenseCTGCTCACACCACTGGGAAG6338
AntisenseCGAGCTTGACTGGAAGATGTC

Egr-1SenseTGACCGCAGAGTCTTTTCCT6335
AntisenseGATGAGCTGGGACTGGTAGC

Foxp1SenseACGCCTACTGCACACCTCTC6330
AntisenseCTTCAGCTTCCTCTGGATCG

IRF-7SenseACTGTGACACCCCCATCTTC6330
AntisenseGCTCCATAAGGAAGCACTCG

PU.1SenseAGATGCACGTCCTCGATACC6330
AntisenseGCTTGGACGAGAACTGGAAG

AML-1: acute myelogenous leukemia-1, Egr-1: early growth response-1, IRF-7: interferon regulatory factor-7.