Table 1: Primer sequences for PCR amplification of cDNA fragments of SLA. Primers were synthesized by MWG, Germany. F: forward primer; R: reverse primer.

ProteinRestriction sitesPrimer sequences (5'–3')

SLA-His-coliBsmBIF: ATTACGTCTCACATGAACCGCGAGAGCTTCGCGGCG
BsmBIR: ATTACGTCTCTTCGAGTGAAGAAGCATCCTGGTATGTGTC

SLA-HEKBsmBIF: ATTACGTCTCACATGAACCGCGAGAGCTTCGCGGCG
BsmBIR: ATTACGTCTCTTCGAGTCATGAAGAAGCATCCTGGTATGTG