- About this Journal
- Abstracting and Indexing
- Aims and Scope
- Article Processing Charges
- Articles in Press
- Author Guidelines
- Bibliographic Information
- Citations to this Journal
- Contact Information
- Editorial Board
- Editorial Workflow
- Free eTOC Alerts
- Publication Ethics
- Reviewers Acknowledgment
- Submit a Manuscript
- Subscription Information
- Table of Contents
Journal of Marine Biology
Volume 2011 (2011), Article ID 934269, 10 pages
doi:10.1155/2011/934269
Widespread Dispersal of the Crown-of-Thorns Sea Star, Acanthaster planci, across the Hawaiian Archipelago and Johnston Atoll
1Joint Institute for Marine and Atmospheric Research, University of Hawai`i, 1000 Pope Road, Honolulu, HI 96822, USA
2Hawaii Institute of Marine Biology, University of Hawaii, P.O. Box 1346, Kaneohe, HI 96744, USA
3University of Hawaii at Hilo, 200 W. Kawili Street, Hilo, HI 96720, USA
4NOAA Pacific Island Fisheries Science Center Coral Reef Ecosystem Division, 1125 B Ala Moana Boulevard, Honolulu, HI 96814, USA
Received 10 July 2010; Accepted 2 October 2010
Academic Editor: Benjamin S. Halpern
Copyright © 2011 Molly A. Timmers et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract
The population structure of marine species is variable along the Hawaiian Archipelago; thus, it is important to understand dispersal and recruitment patterns for economically and ecologically important taxa to inform Ecosystem-based Management. Connectivity of the coral-eating crown-of-thorns sea star, Acanthaster planci, was examined from Johnston Atoll and 12 locations across the Hawaiian Archipelago. Sequences of mitochondrial DNA from 383 individuals were analyzed to infer patterns of gene flow among the Northwestern Hawaiian Islands (NWHIs), the main Hawaiian Islands, and Johnston Atoll. Population samples were genetically similar across the Hawaiian Archipelago with the exception of the west side of the Big Island of Hawaii, which was significantly differentiated from the majority of Hawaiian samples (pairwise , ). Although differentiated, Hawai`i West shares haplotypes with every other site across the Hawaiian Archipelago. Johnston Atoll was genetically distinct from every location (pairwise , ) except French Frigate Shoals (, ), supporting connectivity between the central NWHIs and Johnston Atoll. Taken together with the lack of geographic population structure and haplotypes shared among all populations, these results indicate widespread larval dispersal with few restrictions to gene flow along the archipelago.
1. Introduction
The most geographically isolated island group in the world, the Hawaiian Archipelago, spans 2500 km and is composed of eighteen primary islands, reefs, and atolls separated into the remote Northwestern Hawaiian Islands (NWHIs) and the inhabited main Hawaiian Islands (MHIs). The NWHIs and MHIs are distinguishable by human habitation, geomorphology, and geological age; the MHIs are heavily populated high islands and geologically young, while the NWHIs are geologically older and predominantly uninhabitable low coral islands and atolls. The reefs of the MHIs are anthropogenically impacted from sewage outflow [1–3], alien invasive algae [4–6], overfishing [2, 7], and nutrient discharge [8], whereas the NWHIs have remained relatively pristine [7]. Fish communities and biomass in the NWHIs are unparalleled to the MHIs [7], and in terms of ranking overall “health”, the NWHIs have retained their biological richness and value compared to the MHIs [9–11].
Currently under protection as the Papahānaumokuākea Marine National Monument, the NWHIs remain shielded from most direct threats induced by human activities such as commercial fishing, military use, and tourism [11]. To inform ecosystem-based management in both the Monument and the reefs in the MHIs, it is necessary to know the direction and magnitude of connectivity across the archipelago. Ascertaining whether the NWHIs serve as a recruitment source to the MHIs or whether the MHIs serve as a recruitment source to the NWHIs should be investigated to better support implementation of ecosystem-based approaches to management.
The genetic structure and degree of differentiation among populations of surveyed marine species are highly variable along the Hawaiian Archipelago. Marine species are thought to diverge from their Pacific roots but maintain species cohesion and not diversify in the Hawaiian Archipelago [12–14]. Thus, marine species in Hawai`i were historically expected to be generally well mixed because the spectacular species radiations seen in terrestrial species are not mirrored in the sea, and there is limited evidence to suggest divergence and diversification of marine taxa [12, 14]. Several studies supported this lack of genetic structure for the damselfish, Stegastes fasciolatus [15], the soldierfish, Myripristis berndti [16], the spiny lobster, Panulirus marginatus [17], and the snapper, Pristipomoides filamentosus [18]. In contrast to these examples, however, several marine species have also shown significant genetic differentiation within the Hawaiian Archipelago. For example, the Hawaiian grouper, Epinephelus quernus, exhibits genetic subdivision along the middle of the archipelago [19]. Similarly, subpopulations of the Hawaiian spinner dolphin exist between the MHIs and the NWHIs and within each region [20]. Furthermore, two genetically distinct populations of the endemic bobtail squid, Euprymna scolopes, have been discovered on the island of O`ahu [21]. Finally, major restrictions to gene flow were found within the Hawaiian Archipelago for the subtidal Hawaiian limpet, Cellana talcosa [22], as well as for vermetid gastropods [23]. Research thus far dictates that the levels of connectivity and gene flow between the NWHIs and MHIs and among all Hawaiian islands are highly variable among species [22]. Thus, population structure must be investigated species by species to understand the dispersal and recruitment patterns for economically and ecologically important taxa until sufficient data emerge to make meaningful generalizations.
Here, we investigate the population structure of the ecologically influential, corallivorous crown-of-thorns sea star, Acanthaster planci. Large aggregations of the crown-of-thorns, termed outbreaks, are among the most significant biological disturbances that occur on a tropical reef [24]. Outbreaks can destroy a coral reef [24], change coral community structure [25–27], promote algal colonization [24, 28], and affect fish population dynamics [29–31]. What specifically drives outbreak formation is still unknown, and whether recent outbreaks are more of a human-induced phenomenon as a result of sedimentation and urbanization [32], run-off [32–34], or overfishing [35, 36] rather than a naturally occurring phenomenon remains under debate. Regardless of the mechanism, infestations are detrimental not only ecologically, but also economically by reducing the aesthetic value of coral reefs in locations where the economy is driven by tourism.
Coral reef tourism is a multibillion dollar industry for island nations. Net benefits from Hawaiian coral reefs alone were estimated to be USD $360 million per year [37] with 50 to 60 million a year in revenue from the dive industry [38]. Control and eradication programs have been established in several countries to manage Acanthaster reef impacts for ecological and economical reasons [26, 39]. Knowledge on the dispersal and connectivity patterns of this corallivore along the Hawaiian Archipelago would provide managers with information regarding potential larval pathways enabling them to monitor reef areas that may be at risk to A. planci aggregations and act proactively to control outbreaks and prevent spread.
This paper uses genetic markers (mtDNA) to investigate gene flow and connectivity of A. planci across the Hawaiian Archipelago and Johnston Atoll. Located 865 km to the south-southwest of French Frigate Shoals in the NWHIs, Johnston Atoll is the closest Indo-West Pacific source of marine species that could have potentially populated the Hawaiian Islands and has alternately been proposed as a gateway into Hawai`i and an outpost of Hawaiian diversity. In this study, we ask the following questions. (1) Do populations of A. planci show evidence of genetic subdivision between and within the NWHIs and the MHIs? (2) Is there gene flow among Johnston Atoll, the NWHIs, the MHIs, or all three? (3) Do A. planci populations conform to a genetic isolation by geographic distance (IBD) model along the Hawaiian Archipelago?
2. Materials and Methods
2.1. Sampling
Adult Acanthaster planci were collected between 2005 and 2007 from Johnston Atoll and 11 sites along the 2500 km long Hawaiian Archipelago (Figure 1). Of those 11 sites, two were in the NWHIs (Pearl and Hermes Atoll and French Frigate Shoals) and nine within the MHIs (Ni`ihau, Kaua`i, O`ahu, Maui, Moloka`i, Lana`i, Hawai`i East, Hawai`i West, and Hawai`i South). Sites, Oahu and Hawai`i East, were outbreak populations having greater than 1500 sea stars/km2 [40]. Live stars were sampled nonlethally by snipping off an arm tip in the field by means of both free diving and SCUBA [41]. Tube feet tissue was preserved in 95% ethanol and stored at −20°C. In addition, 44 samples collected in 1982 from an unknown location of the Big Island of Hawai`i were used in this study. For these historical samples, whole animals were collected and pyloric caeca were preserved in 95% ethanol before being stored at −20°C.
2.2. DNA Extraction and PCR
Two different procedures were used for DNA extraction and amplification based on the tissue type and age of the samples. DNA extractions mirrored the protocols described in Jessop [42] or the Hotshot boiling protocol [43].
Approximately 530 base pairs of the noncoding mitochondrial DNA control region were amplified using polymerase chain reaction (PCR) with the following primers: COTS-ctrl-fwd 5'CAAAAGCTGACGGGTAAGCAA3' and COTS-ctrl-rvs 5'TAAGGAAGTTTGCGACCTCGAT3' (Volger et al., unpublished). 100 μl PCR reactions were performed for tube feet samples using 30 μl of dH20, 10 μl of template, 10 μl of each primer (5 μM), and 50 μl of Promega MasterMix. The PCR for historical samples occurred in 25 μl reactions with 2.5 μl of 10X buffer, 5 μl of dNTPs (2 μM), 1 μl of MgCl2 (1.5 mM), 0.5 μl of each primer (0.2 μM), 0.5 μl of template, and 1.5 U of Bioline’s Immolase Taq polymerase. Thermocycling for all samples was performed with an initial denaturation at 94°C for 5 min, 34 cycles (94°C for 30 s, 55°C for 1 min, and 72°C for 1 min), and a final extension for 10 min at 72°C. PCR products from tube feet samples were cleaned using UltraClean PCR kit (MO BIO Laboratories). PCR products from 1982 samples were treated with 1.5 μl of exonuclease I and 1.5 μl of calf intestinal alkaline phosphatase (Exo-CIAP), incubated at 37°C for 60 minutes, and then deactivated at 85°C for 15 minutes.
Amplified DNA fragments were sequenced in the reverse direction, and all unique or questionable sequences were repeated using an alternate reverse primer on an ABI 3130XL automated sequencer (Applied Biosystems Incorporated).
2.3. Data Analysis
Sequences were compared, and assembled using SEQUENCHER (v4.52b; Gene Codes Corporation, Ann Arbor, MI, USA). Sequences were aligned using MANGO (multiple alignment with gapped oligos) because this program uses a novel orthogonal multiple sequence alignment method that processes information of all sequences as a whole and builds the alignment vertically, avoiding the “once a gap, always a gap” alignment phenomenon [44]. Gap placement was then double checked by eye using Bioedit [45], and haplotypes were determined based on sequence identity.
A median joining haplotype network with the default weight of 10 applied to each character was created using NETWORK ver 4.5 (Fluxus Technology Ltd., Suffolk England) to illustrate haplotype variability and clustering. An analysis of molecular variance (AMOVA) was conducted using ARLEQUIN 3.1 [46]. A Kimura 2P model [47] was determined to be the most appropriate model for these data as determined by MODELTEST 3.7 [48]; therefore, all AMOVA analyses assumed this base substitution model. Haplotype diversity (), nucleotide diversity (), and population pairwise values were calculated in ARLEQUIN. A partial mantel test as implemented in IBDWS [49] was used to determine if genetic distance was correlated with geographic distance between islands.
3. Results
A total of 383 specimens of A. planci were sampled. There were 308 haplotypes, of which 125 were singletons (Table 1). Haplotype diversity was high both overall ( or 50 effective haplotypes) and within sample locations (; Table 1). The overall nucleotide diversity was , and within sample locations .
The median joining network revealed no obvious association between haplotype and geographic location (Figure 2). Haplotypes were not clustered in distinguishable groups. When haplotypes of the 1982 samples were added, there was no distinction between the older samples and the newer ones (Figure 2).
Excluding Johnston Atoll, an AMOVA to test the separation of the NWHIs and the MHIs detected no significant difference among regions (, ), but significant differences were detected among populations within regions (, ). Including all populations, there was an indication of population partitioning between Johnston Atoll and all sites within the Hawaiian Archipelago (, ), with 5.24% of the genetic variation explained by these groups.
Pairwise population fixation () values revealed two locations significantly differentiated from the rest of the archipelago: Johnston Atoll and Hawai`i West (Table 3). Given these results, a post hoc AMOVA was conducted to look for regional differences between Johnston Atoll, Hawai`i West, and the rest of the archipelago. Significant differences were found among regions, explaining 5.71% of the genetic variation (, , Table 2).
Pairwise values were used to assess whether genetic and geographic distances conformed to the Isolation by Distance model. Only 8% of the relationship was explained () by the IBDWS model, and the associated Mantel test indicated no significant correlation between genetic and geographic distances (, , ). When log transformed, the results remained similar (, , ).
4. Discussion
4.1. Connectivity along the Hawaiian Archipelago
Acanthaster planci larvae are planktotrophic and, based on laboratory rearing, have an estimated pelagic larval duration (PLD) of 42 days [50]. Their resilience to temperature and salinity changes [51], and adaptation to limited nutrients [50] enable A. planci larvae to survive in a broad range of conditions which is thought to facilitate long-distance dispersal [50–53]. In addition to having resilient larvae, adults are fecund broadcast spawners. Females release up to 108 eggs during one spawning season and can spawn for up to 4 years of their approximated 8-year lifespan [26, 54]. The use of PLD as a reliable proxy for dispersal potential has been questioned in several recent meta-analyses of the existing literature [55–58]. In this case, however, the data support the expectations based on life-history traits. The haplotype network (Figure 2), the nonsignificant AMOVA between the NWHIs and the MHIs populations (, ), and the lack of significant isolation by distance () indicate that, with the exception of the Hawai`i West population, A. planci in the Hawaiian Archipelago experience few barriers to gene flow. Furthermore, the shared haplotypes between the 1982 samples with locations throughout the archipelago today suggest long-term mixing of the populations.
The distance traveled during pelagic development is obviously a function of both PLD and of the oceanic currents in which those larvae find themselves [59–62]. Thus, the mechanism for this widespread dispersal is likely the variable currents that flow along the 2500 km archipelago. The prevailing oceanic currents that run along the Hawaiian Archipelago—the west/northwestward flowing North Hawaiian Ridge Current (NHRC), the eastward Hawaiian Lee Countercurrent (HLC), and the Subtropical Countercurrent (SCC)—are conducive to the widespread dispersal of species with long-lived larvae that leave the coastal realm [63, 64]. With the NHRC, recruitment is more likely to move from the MHIs to the NWHIs [65]. However, the SCC has been found, in part, to drive recruitment of spiny lobsters from the NWHIs atolls down the chain [66]. In addition to the prevailing currents, there are wind-driven southwesterly flowing currents moving through the channels of the MHIs [67], and all currents within the archipelago are dominated by eddies and are unstable because of mesoscale and seasonal variability [64, 67, 68].
The temporal and spatial dynamics of all these currents along and within the archipelago provide the mechanism for A. planci larvae to disperse widely and haphazardly up and down the chain thereby facilitating mixing. Thus, the isolation of the Hawai`i West population from the rest of the Hawaiian Archipelago samples, with the exception of Ni`ihau (, ), is surprising. However, this pattern of isolation has also been seen with anchialine shrimp [69], yellow tang [70], and multiple species of vermetid gastropods [23], where the populations on the west side of Hawai`i Island were strongly subdivided from the rest of the Big Island, and the other MHIs [71, 72].
The west leeward side of Hawai`i island is an active area for eddy formation [73]. Two to three times a year anticyclonic eddies form, propagate to the southwest, and approach the westward flowing North Equatorial Current moving away from the Hawaiian Archipelago [74]. These eddies may be limiting larval dispersal from the leeward side of Hawai`i island to the rest of the chain and from the chain to the west side. Mesoscale and submesoscale circulation may minimize long-distance dispersal of larvae [75]. Eddies and gyres have caused larval retention in some reefs along the Great Barrier Reef [76] and in Guam [77]. Eddy systems capture larvae and advect them to deep oceanic waters where they have a higher likelihood of perishing [75]. The eddies occurring along the west side of Hawai`i island seem a likely candidate driving the isolation of this population. Despite the significant genetic differentiation, however, gene flow does exist because Hawai`i West shares haplotypes with every island, including Johnston Atoll, and thus is not completely isolated or self-sustaining.
4.2. Connectivity between Johnston Atoll and the Hawaiian Archipelago
Johnston Atoll is the most geographically isolated population in this study and the closest Indo-West Pacific source of marine species that could have potentially populated the Hawaiian Islands. It has long been postulated that species disperse readily from Johnston Atoll to French Frigate Shoals (FFSs) in the NWHIs. The first indirect evidence came from coral surveys comparing species at Johnston Atoll with the Hawaiian Islands. These surveys found that the most abundant coral at Johnston Atoll, Acropora cythera, was prevalent at FFSs but extremely rare elsewhere in the Hawaiian Archipelago [78, 79]. The next indirect evidence was demonstrated using computer simulations that revealed FFSs as being oceanographically connected to Johnston Atoll via the SCC and HLC for larvae with a days [63]; A. planci fit this model. The FFSs population in this study was the only one that was not significantly different from Johnston Atoll (, ). The genetic similarity between FFSs and Johnston Atoll to the exclusion of all other Hawaiian islands supports the FFSs and Johnston Atoll connection. In contrast, gene flow between Johnston Atoll and the remaining Hawaiian Islands is clearly limited (pairwise , ).
5. Conclusion
Although some genetic structuring was found between Hawai`i West and the rest of the Hawaiian Archipelago, the absence of A. planci genetic population structure along 2500 km of the Hawaiian Archipelago indicates that the dispersal potential of this coral-eating sea star is vast. High dispersal is generally associated with a lack of genetic population structure [80, 81]. The genetic pattern found is driven by the dynamic nature and seasonality of the variable currents and eddies that stretch across the chain. The numerous islands and reefs along the chain provide stepping stones for population expansion. It is likely the larvae released in the MHIs will eventually have progeny in the NWHIs and vise versa.
Understanding A. planci dispersal and recruitment mechanisms has become important for reef managers in order to mitigate their populations and monitor their impacts on reef communities. Ecosystem-based management is attractive in this case because in addition to the possible role of anthropogenic activities in initiating outbreaks, these coral-eating sea stars impact more than just the habitat-forming corals on which they prey and can alter entire coral reef ecosystems [26, 82–84]. With coral reef tourism being a multibillion dollar industry, A. planci outbreaks could severely impact the economics of island nations. For example, outbreaks on the Great Barrier Reef (GBR), Guam, American Samoa, and Japan have resulted in up to 90% coral mortality in localized areas [85–88]. In the GBR recruitment pathways from mass spawning events have been predicted based on the flow of the East Australian Current [89, 90], and eradication programs have been established to remove A. planci populations upstream in order to limit population expansion downstream [91]. The same is true in Japan along the Kurioshio Current [92]. Unlike the GBR and Japan, it will be more difficult to predict potential recruitment pathways in the Hawaiian Archipelago due to the variable currents and high population mixing along the chain.
Acknowledgments
The authors would like to thank K. Koyanagi, K. O’Brien, A. Hall, S. Godwin, D. Merritt, H. Sandison, O. Vetter, K. Osada, J. Asher, J. Eble, J. Mitchell, A. Palmer, A. Long, J. Gove, F. Mancini, D. White, C. Meyer, B. Carman, J. Starmer, M. Ferguson, K. Lino, F. Stanton, B. Zgliczynski, R. Watanuki, E. Keenan, E. Smith, S. Kahng, K. Hogrefe, S. Charette, R. Boland, K. Kageyama, J. Chojnacki, D. Levault, J. Blodgett, C. Young III, B. DeJoseph, E. Coccagna, R. Moffitt, E. Brown, S. Hau, S. Cooper-Alletto, J. Watkins, R. Hoeke, P. Ayotte, N. Pomeroy, P. Brown, V. Martocci, D. Shilling, M. Iacchei, I. Williams, S. Cotton, B. Walsh, S. Kosta, C. Kress, G. Conception, M. Lamson, M. Gaither, and P. Fiene for help in specimen collection. The authors would like to thank Bubbles Below Scuba Charter, Mike Severns Diving, and Extended Horizons Scuba Charter for their support. They also thank C. Volger for her PCR protocols and primer sequences and they thank N. Yashuda and M. Nishisa for allowing them to use their samples from 1982. They thank P. Vroom, D. Kobayashi, J. Asher, and R. Withall for their comments. This work was financed by EPSCoR research Enhancement Activities Program (REAP), the National Oceanic and Atmospheric Administration, the National Science Foundation (OCE no. 06-23678), the National Marine Sanctuaries NWHIsCRER-HIMB partnership (MOA-2005–008/6882), and a Sigma-Xi Grant-in-Aid research scholarship.
References
- M. M. Littler and D. S. Littler, “Models of tropical reef biogenesis: the contribution of algae,” Progress in Phycological Research, vol. 3, pp. 323–364, 1984.
- R. W. Grigg, “Effects of sewage discharge, fishing pressure and habitat complexity on coral ecosystems and reef fishes in Hawaii,” Marine Ecology Progress Series, vol. 103, no. 1-2, pp. 25–34, 1994. View at Scopus
- C. L. Hunter and C. W. Evans, “Coral reefs in Kaneohe Bay, Hawaii: two centuries of western influence and two decades of data,” Bulletin of Marine Science, vol. 57, no. 2, pp. 501–515, 1995. View at Scopus
- S. K. Rodgers and E. F. Cox, “Rate of spread of introduced rhodophytes Kappaphycus alvarezii, Kappaphycus striatum, and Gracilaria salicornia and their current distribution in Kane'ohe Bay, O'ahu, Hawai'i,” Pacific Science, vol. 53, no. 3, pp. 232–241, 1999.
- E. J. Conklin and J. E. Smith, “Abundance and spread of the invasive red algae, Kappaphycus spp., in Kane'ohe Bay, Hawaii and an experimental assessment of management options,” Biological Invasions, vol. 7, no. 6, pp. 1029–1039, 2005. View at Publisher · View at Google Scholar · View at Scopus
- J. E. Smith, J. W. Runcie, and C. M. Smith, “Characterization of a large-scale ephemeral bloom of the green alga Cladophora sericea on the coral reefs of West Maui, Hawai'i,” Marine Ecology Progress Series, vol. 302, pp. 77–91, 2005. View at Scopus
- A. M. Friedlander and E. E. DeMartini, “Contrasts in density, size, and biomass of reef fishes between the northwestern and the main Hawaiian islands: the effects of fishing down apex predators,” Marine Ecology Progress Series, vol. 230, pp. 253–264, 2002. View at Scopus
- J. H. Street, K. L. Knee, E. E. Grossman, and A. Paytan, “Submarine groundwater discharge and nutrient addition to the coastal zone and coral reefs of leeward Hawaii,” Marine Chemistry, vol. 109, no. 3-4, pp. 355–376, 2008. View at Publisher · View at Google Scholar · View at Scopus
- P. L. Jokiel and K. S. Rodgers, “Ranking coral ecosystem “health and value” for the islands of the Hawaiian Archipelago,” Pacific Conservation Biology, vol. 13, no. 1, pp. 60–68, 2007. View at Scopus
- K. S. Rodgers, P. L. Jokiel, C. E. Bird, and E. K. Brown, “Quantifying the condition of Hawaiian coral reefs,” Aquatic Conservation: Marine and Freshwater Ecosystems, vol. 20, no. 1, pp. 93–105, 2010. View at Publisher · View at Google Scholar
- K. A. Selkoe, B. S. Halpern, C. M. Ebert et al., “A map of human impacts to a “pristine” coral reef ecosystem, the Papahānaumokuākea Marine National Monument,” Coral Reefs, vol. 28, no. 3, pp. 635–650, 2009. View at Publisher · View at Google Scholar · View at Scopus
- E. A. Kay and S. R. Palumbi, “Endemism and evolution in Hawaiian marine invertebrates,” Trends in Ecology and Evolution, vol. 2, no. 7, pp. 183–186, 1987. View at Scopus
- T. F. Hourigan and E. S. Reese, “Mid-ocean isolation and the evolution of Hawaiian reef fishes,” Trends in Ecology and Evolution, vol. 2, no. 7, pp. 187–191, 1987. View at Scopus
- P. L. Jokiel, “Ecology, biogeography and evolution of corals in Hawaii,” Trends in Ecology and Evolution, vol. 2, no. 7, pp. 179–182, 1987. View at Scopus
- J. B. Shaklee, “Genetic variation and population structure in the damselfish, Stegastes fasciolatus, throughout the Hawaiian Archipelago,” Copeia, vol. 3, pp. 629–640, 1984.
- M. T. Craig, J. A. Eble, B. W. Bowen, and D. R. Robertson, “High genetic connectivity across the Indian and Pacific Oceans in the reef fish Myripristis berndti (Holocentridae),” Marine Ecology Progress Series, vol. 334, pp. 245–254, 2007. View at Publisher · View at Google Scholar · View at Scopus
- J. B. Shaklee and P. B. Samollow, “Genetic variation and population structure in a spiny lobster, Panulirus marginatus, in the Hawaiian Archipelago,” Fishery Bulletin, vol. 82, no. 4, pp. 693–702, 1984. View at Scopus
- J. B. Shaklee and P. B. Samollow, “Genetic aspects of population structure of four species in the Northwestern Hawaiian Islands,” in Proceedings of the Symposium on the Status of Resource Investigations in the Northwestern Hawaiian Islands, R. W. Grigg and R. T. Pfund, Eds., 1980, SeaGrant Miscellaneous Report UNIHI-SEAGRANT-MR-80-04:264-277.
- M. A. J. Rivera, C. D. Kelley, and G. K. Roderick, “Subtle population genetic structure in the Hawaiian grouper, Epinephelus quernus (Serranidae) as revealed by mitochondrial DNA analyses,” Biological Journal of the Linnean Society, vol. 81, no. 3, pp. 449–468, 2004. View at Publisher · View at Google Scholar · View at Scopus
- K. R. Andrews, L. Karczmarski, W. W. L. Au, S. H. Rickards, C. A. Vanderlip, and R. J. Toonen, “Patterns of genetic diversity of the Hawaiin spinner dolphin (Stenella longirostris),” Atoll Research Bulletin, no. 543, pp. 65–73, 2006. View at Scopus
- J. R. Kimbell, M. J. McFall-Ngai, and G. K. Roderick, “Two genetically distinct populations of bobtail squid, Euprymna scolopes, exist on the Island of O'ahu,” Pacific Science, vol. 56, no. 3, pp. 347–355, 2002. View at Scopus
- C. E. Bird, B. S. Holland, B. W. Bowen, and R. J. Toonen, “Contrasting phylogeography in three endemic Hawaiian limpets (Cellana spp.) with similar life histories,” Molecular Ecology, vol. 16, no. 15, pp. 3173–3186, 2007. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
- A. Faucci, The influence of larval dispersal potential on speciation, phylogeography, and genetic population structure in two pacific marine snail groups, dissertation, University of Hawaii, 2007.
- P. J. Moran, “The Acanthaster phenomenon,” Oceanography and Marine Biology Annual Review, vol. 24, pp. 379–480, 1986.
- J. M. Branham, S. A. Reed, J. H. Bailey, and J. Caperon, “Coral-eating sea stars Acanthaster planci in Hawaii,” Science, vol. 172, no. 3988, pp. 1155–1157, 1971. View at Scopus
- C. Birkeland and J. S. Lucas, Acanthaster planci: Major Management Problem of Coral Reefs, CRC Press, Boca Raton, Fla, USA, 1990.
- M. S. Pratchett, “Feeding preferences of Acanthaster planci (Echinodermata: Asteroidea) under controlled conditions of food availability,” Pacific Science, vol. 61, no. 1, pp. 113–120, 2007. View at Scopus
- P. J. Moran, R. H. Bradbury, and R. E. Reichelt, “Mesoscale studies of the crown-of-thorns/coral interaction: a case history from the Great Barrier Reef,” in Proceedings of the 5th International Coral Reef Congress, vol. 5, pp. 321–326, 1985.
- D. M. B. Williams, “Temporal variation in the structure of reef slope fish communities (central Great Barrier Reef): short-term effects of Acanthaster planci infestation,” Marine Ecological Progress Series, vol. 28, pp. 157–164, 1986.
- A. M. Hart and D. W. Klumpp, “Response of herbivorous fishes to crown-of-thorns starfish Acanthaster planci outbreaks. I. Substratum analysis and feeding ecology of Acanthurus nigrofuscus and Scarus frenatus,” Marine Ecology Progress Series, vol. 132, no. 1–3, pp. 11–19, 1996. View at Scopus
- A. M. Hart, D. W. Klumpp, and G. R. Russ, “Response of herbivorous fishes to crown-of-thorns starfish Acanthaster planci outbreaks. II. Density and biomass of selected species of herbivorous fish and fish-habitat correlations,” Marine Ecology Progress Series, vol. 132, no. 1–3, pp. 21–30, 1996. View at Scopus
- J. Brodie, K. Fabricius, G. De'ath, and K. Okaji, “Are increased nutrient inputs responsible for more outbreaks of crown-of-thorns starfish? An appraisal of the evidence,” Marine Pollution Bulletin, vol. 51, no. 1-4, pp. 266–278, 2005. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
- J. E. Randall, “Chemical pollution in the sea and the crown-of-thorns starfish,” Biotropica, vol. 4, no. 3, pp. 132–144, 1972.
- C. Birkeland, “Terrestrial runoff as a cause of outbreaks of Acanthaster planci (Echinodermata: Asteroidea),” Marine Biology, vol. 69, no. 2, pp. 175–185, 1982. View at Publisher · View at Google Scholar · View at Scopus
- R. Endean, Report on investigations made into aspects of the current Acanthaster planci infestations of certain reefs of the Great Barrier Reef, Fisheries Branch, Brisbane, Australia, 1969.
- N. K. Dulvy, R. P. Freckleton, and N. V. C. Polunin, “Coral reef cascades and the indirect effects of predator removal by exploitation,” Ecology Letters, vol. 7, no. 5, pp. 410–416, 2004. View at Publisher · View at Google Scholar · View at Scopus
- H. S. J. Cesar and P. J. H. van Beukering, “Economic valuation of the coral reefs of Hawaii,” Pacific Science, vol. 58, no. 2, pp. 231–242, 2004. View at Scopus
- P. J. H. van Beukering and H. S. J. Cesar, “Ecological economic modeling of coral reefs: evaluating tourist overuse at Hanauma Bay and algae blooms at the Kīhei Coast, Hawai'i,” Pacific Science, vol. 58, no. 2, pp. 243–260, 2004. View at Scopus
- GBRMPA, Tourism Operator’s Handbook for the Great Barrier Reef, Publication Great Barrier Reef Marine Park Authority, Townsville, Australia, 2000.
- P. J. Moran and G. De'ath, “Estimates of the abundance of the crown-of-throns starfish Acanthaster planci in outbreaking and non-outbreaking populations on reefs within the Great Barrier Reef,” Marine Biology, vol. 113, no. 3, pp. 509–515, 1992. View at Publisher · View at Google Scholar · View at Scopus
- D. J. Skillings and R. J. Toonen, “Just a Flesh Wound: Non-lethal Sampling for Conservation Genetics Studies,” in Proceedings of the 29th American Academy of Underwater Sciences Symposium: Diving for Science, N. W. Pollock, Ed., AAUS, 2009.
- H. Jessop, Sibling sea urchin species of the genus Echinothrix in Hawaii: Unification of morphological characters and genetic clades, dissertation, University of Hawaii at Hilo, 2008.
- N. D. Meeker, S. A. Hutchinson, L. Ho, and N. S. Trede, “Method for isolation of PCR-ready genomic DNA from zebrafish tissues,” BioTechniques, vol. 43, no. 5, pp. 610–614, 2007. View at Publisher · View at Google Scholar · View at Scopus
- Z. Zhang, H. Lin, and M. Li, “Mango: multiple alignment with N gapped oligos,” Journal of Bioinformatics and Computational Biology, vol. 6, no. 3, pp. 521–541, 2008. View at Publisher · View at Google Scholar · View at Scopus
- T. A. Hall, “BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT,” Nucleic Acids Symposium Series, vol. 41, pp. 95–98, 1999.
- L. Excoffier, G. Laval, and S. Schneider, “Arlequin (version 3.11): an integrated software package for population genetics data analysis,” Evolutional Biology Online, vol. 1, pp. 47–50, 2005.
- M. Kimura, “A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences,” Journal of Molecular Evolution, vol. 16, no. 2, pp. 111–120, 1980. View at Scopus
- D. Posada and K. A. Crandall, “MODELTEST: testing the model of DNA substitution,” Bioinformatics, vol. 14, no. 9, pp. 817–818, 1998. View at Scopus
- J. L. Jensen, A. J. Bohonak, and S. T. Kelley, “Isolation by distance, web service,” BMC Genetics, vol. 6, article 13, 2005. View at Publisher · View at Google Scholar · View at PubMed
- J. S. Lucas, “Quantitative studies of feeding and nutrition during larval development of the coral reef asteroid Acanthaster planci (L.),” Journal of Experimental Marine Biology and Ecology, vol. 65, no. 2, pp. 173–193, 1982. View at Scopus
- L. G. Johnson and R. C. Babcock, “Temperature and the larval ecology of the crown-of-thorns starfish, Acanthaster planci,” Biological Bulletin, vol. 187, no. 3, pp. 304–308, 1994. View at Scopus
- J. S. Lucas, “Reproductive and larval biology of Acanthaster planci (L.) in Great barrier Reef waters,” Micronesica, vol. 9, pp. 197–203, 1973.
- J. S. Lucas, Environmental influences on the early development of Acanthaster planci (L.), in Crown of thorns starfish seminar proceedings, Australian Government Publishing Services, Canberra, Australia, 1975.
- R. C. Babcock and C. N. Mundy, “Reproductive biology, spawning and field fertilization rates of Acanthaster planci,” Australian Journal of Marine & Freshwater Research, vol. 43, no. 3, pp. 525–534, 1992. View at Scopus
- I. R. Bradbury, B. Laurel, P. V. R. Snelgrove, P. Bentzen, and S. E. Campana, “Global patterns in marine dispersal estimates: the influence of geography, taxonomic category and life history,” Proceedings of the Royal Society B, vol. 275, no. 1644, pp. 1803–1809, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
- P. M. Ross, I. D. Hogg, C. A. Pilditch, and C. J. Lundquist, “Phylogeography of New Zealand’s coastal benthos,” New Zealand Journal of Marine and Freshwater Research, vol. 43, pp. 1009–1027, 2009.
- A. L. Shanks, “Pelagic larval duration and dispersal distance revisited,” Biological Bulletin, vol. 216, no. 3, pp. 373–385, 2009. View at Scopus
- K. Weersing and R. J. Toonen, “Population genetics, larval dispersal, and connectivity in marine systems,” Marine Ecology Progress Series, vol. 393, pp. 1–12, 2009. View at Publisher · View at Google Scholar · View at Scopus
- I. B. Baums, C. B. Paris, and L. M. Chérubin, “A bio-oceanographic filter to larval dispersal in a reef-building coral,” Limnology and Oceanography, vol. 51, no. 5, pp. 1969–1981, 2006. View at Scopus
- M. N. Dawson and W. M. Hamner, “A biophysical perspective on dispersal and the geography of evolution in marine and terrestrial systems,” Journal of the Royal Society Interface, vol. 5, no. 19, pp. 135–150, 2008. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
- C. White, K. A. Selkoe, J. Watson, D. A. Siegel, D. C. Zacherl, and R. J. Toonen, “Ocean currents help explain population genetic structure,” Proceedings of the Royal Society B, vol. 277, no. 1688, pp. 1685–1694, 2010. View at Publisher · View at Google Scholar · View at PubMed
- E. A. Treml, P. N. Halpin, D. L. Urban, and L. F. Pratson, “Modeling population connectivity by ocean currents, a graph-theoretic approach for marine conservation,” Landscape Ecology, vol. 23, no. 1, pp. 19–36, 2008. View at Publisher · View at Google Scholar · View at Scopus
- D. R. Kobayashi, “Colonization of the Hawaiian Archipelago via Johnston Atoll: a characterization of oceanographic transport corridors for pelagic larvae using computer simulation,” Coral Reefs, vol. 25, no. 3, pp. 407–417, 2006. View at Publisher · View at Google Scholar · View at Scopus
- D. R. Kobayashi and J. J. Polovina, “Simulated seasonal and interannual variability in larval transport and oceanography in the Northwestern Hawaiian Islands using satellite remotely sensed data and computer modeling,” Atoll Research Bulletin, no. 543, pp. 365–390, 2006. View at Scopus
- J. Firing and R. E. Brainard, “Ten years of shipboard ADCP measurements along the Northwestern Hawaiian Islands,” Atoll Research Bulletin, no. 543, pp. 347–363, 2006. View at Scopus
- J. J. Polovina and G. T. Mitchum, “Variability in spiny lobster Panulirus marginatus recruitment and sea level in the northwestern Hawaiian Islands,” Fishery Bulletin, vol. 90, no. 3, pp. 483–493, 1992. View at Scopus
- B. Qiu, D. A. Koh, C. Lumpkin, and P. Flament, “Existence and formation mechanism of the North Hawaiian Ridge Current,” Journal of Physical Oceanography, vol. 27, no. 3, pp. 431–444, 1997. View at Scopus
- F. Kobashi and H. Kawamura, “Seasonal variation and instability nature of the North Pacific Subtropical Countercurrent and the Hawaiian Lee Countercurrent,” Journal of Geophysical Research C, vol. 107, no. 11, pp. 6.1–6.18, 2002. View at Scopus
- S. R. Santos, “Patterns of genetic connectivity among anchialine habitats: a case study of the endemic Hawaiian shrimp Halocaridina rubra on the island of Hawaii,” Molecular Ecology, vol. 15, no. 10, pp. 2699–2718, 2006. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus
- J. A. Eble, Phylogeographic insights into the ecology and evolution of Indo-Pacific reef fishes, University of Hawaii at Manoa, 2010.
- R. J. Toonen, C. E. Bird, J. Eble, et al., “Where have all the larvae gone? Patterns of connectivity in the Hawaiian Archipelago,” in Proceedings of the 29th American Academy of Underwater Sciences Symposium: Diving for Science, N. W. Pollock, Ed., AAUS, 2010.
- R. Toonen, C. Bird, and J. Eble, “Defining boundaries for applying Ecosystem-based management: a multispecies case study of marine connectivity across the Hawaiian Archipelago,” current issue.
- K. Wyrtki, “Eddies in the Pacific North Equatorial Current,” Journal of Physical Oceanography, vol. 12, pp. 746–749, 1982.
- C. L. Holland and G. T. Mitchum, “Propagation of Big Island eddies,” Journal of Geophysical Research C, vol. 106, no. 1, pp. 935–944, 2001. View at Scopus
- E. Wolanski and W. M. Hamner, “Topographically controlled fronts in the ocean and their biological influence,” Science, vol. 241, no. 4862, pp. 177–181, 1988. View at Scopus
- F. Rowe and L. Vail, “Is the crown-of-thorns ravaging the reef?” Australia Natural History, vol. 21, pp. 195–196, 1984.
- D. P. Cheney, “Spawning and aggregation of Acanthaster planci in Micronesia,” in Proceedings of the 2nd International Coral Reef Symposium, vol. 1, pp. 591–594, 1974.
- R. W. Grigg, “Acropora in Hawaii. Part 2. Zoogeography,” Pacific Science, vol. 35, pp. 15–24, 1991.
- J. E. Maragos and P. L. Jokiel, “Reef corals of Johnston Atoll: one of the world's most isolated reefs,” Coral Reefs, vol. 4, no. 3, pp. 141–150, 1986. View at Publisher · View at Google Scholar · View at Scopus
- B. P. Kinlan, S. D. Gaines, and S. E. Lester, “Propagule dispersal and the scales of marine community process,” Diversity and Distributions, vol. 11, no. 2, pp. 139–148, 2005. View at Publisher · View at Google Scholar · View at Scopus
- A. J. Bohonak, “Dispersal, gene flow, and population structure,” Quarterly Review of Biology, vol. 74, no. 1, pp. 21–45, 1999. View at Scopus
- P. W. Glynn, “The impact of Acanthaster on corals and coral reefs in the Eastern Pacific,” Environmental Conservation, vol. 1, no. 4, pp. 295–304, 1974. View at Scopus
- M. Sano, M. Shimizu, and Y. Nose, “Long-term effects of destruction of hermatypic corals by Acanthaster planci infestation on reef fish communities at Iriomote Island, Japan,” Marine Ecological Progress Series, vol. 37, pp. 191–199, 1987.
- J. S. Beukers and G. P. Jones, “Habitat complexity modifies the impact of piscivores on a coral reef fish population,” Oecologia, vol. 114, no. 1, pp. 50–59, 1998. View at Publisher · View at Google Scholar · View at Scopus
- R. H. Chesher, “Destruction of pacific corals by the sea star Acanthaster planci,” Science, vol. 165, no. 3890, pp. 280–283, 1969. View at Scopus
- M. Yamaguchi, “Acanthaster planci infestations of reefs and coral assemblages in Japan: a retrospective analysis of control efforts,” Coral Reefs, vol. 5, no. 1, pp. 23–30, 1986. View at Publisher · View at Google Scholar · View at Scopus
- P. J. Moran, R. H. Bradbury, and R. E. Reichelt, “Distribution of recent outbreaks of the crown-of-thorns starfish (Acanthaster planci) along the Great Barrier Reef: 1985-1986,” Coral Reefs, vol. 7, no. 3, pp. 125–137, 1988. View at Publisher · View at Google Scholar · View at Scopus
- W. J. Thomas, “Fagatele Bay: a sanctuary in Samoa,” Oceanus, vol. 31, no. 1, pp. 18–24, 1988. View at Scopus
- W. J. Nash, M. Goddard, and J. S. Lucas, “Population genetic studies of the crown-of-thorns starfish, Acanthaster planci (L.), in the Great Barrier Reef region,” Coral Reefs, vol. 7, no. 1, pp. 11–18, 1988. View at Publisher · View at Google Scholar · View at Scopus
- J. A. H. Benzie and J. A. Stoddart, “Genetic structure of outbreaking and non-outbreaking crown-of-thorns starfish (Acanthaster planci) populations on the Great Barrier Reef,” Marine Biology, vol. 112, no. 1, pp. 119–130, 1992. View at Publisher · View at Google Scholar · View at Scopus
- D. A. Fisk and M. C. Power, “Development of cost-effective control strategies for crown-of-thorns starfish,” Tech. Rep. 25, CRC Reef Research Centre, Townsville, Australia, 1999.
- N. Yasuda, S. Nagai, M. Hamaguchi, K. Okaji, K. GÉrard, and K. Nadaoka, “Gene flow of Acanthaster planci (L.) in relation to ocean currents revealed by microsatellite analysis,” Molecular Ecology, vol. 18, no. 8, pp. 1574–1590, 2009. View at Publisher · View at Google Scholar · View at PubMed · View at Scopus