Superparamagnetic Nanoparticles and RNAi-Mediated Gene Silencing: Evolving Class of Cancer Diagnostics and Therapeutics

Table 3

SPION formulation for the delivery and tracking/imaging siRNA in cancer cells.

S. no. SPION preparation	Coating	Targeting ligands	Imaging of internalized SPION	Cell line	Target	siRNA sequence	REF
(1) Coprecipitation	Chitosan, PEG, and PEI	CTX peptide	MRI; Flow cytometry of Dy547-labelled siRNA	C6 rat glioma cells	GFP expression	5′GAACUUCAGGGUCAGCUUGCUU3′; sense and 5′GCAAGCUGACCCUGAAGUUCUU3′; antisense	[37]
(2) Thermal decomposition	Oleic acid, PEI, and PEG	CTX peptide	MRI; ferrozine-based assay	C6 cells	GFP	5′GAACUUCAGGGUCAGCUUGCUU3′; sense and 5′GCAAGCUGACCCUGAAGUUCUU3′; antisense,	[38]
(3) Dextran coated iron oxide colloid crosslinked with epichlorohydrin, and treated with ammonia	Dextran	MPAP peptide	MRI; optical imaging of Cy5.5-labelled SPIONs	LS174T and 9L	GFP	5′-GCA AGC TGA CCC TGA AGT TC-3′	[39]
(4) Thermal decomposition	PEG, and PPI G5	LHRH peptide	MRI; FAM-labeled siRNA complexes analyzed by fluorescence and confocal microscopes	A549 and SKOV-3	BCL2 and β2-microglobulin	GGA TTG TGG CCT TCT TTG AG; sense, CCA AAC TGA GCA GAG TCT TC; antisense and; ACC CCC ACTGAA AAA GAT GA; sense, ATC TTC AAA CCT CCATGA TG; antisense.	[40]