Table 1: Primer list.

GenePrimer sequences (5–3)HGNC IDAnnealing temp (°C)Cycle numberProduct size (bp)Reference

ALPLATCTTTGGTCTGGCCCCCATG ATGCAGGCTGCATACGCCATHGNC: 4385935287[14]
RUNX2CAGTTCCCAAGCATTTCATCC TCAATATGGTCGCCAAACAGHGNC: 104725535444[15]
SPP1AAGCGAGGAGTTGAATGG GGAAAGTTCCTGACTATCHGNC: 112555135220[14]
BGLAPGCCGTAGAAGCGCCGATAGGC ATGAGAGCCCTCACACTCCTCHGNC: 10434935294[14]
COL1A1CCACCAATCACCTGCGTACAGAAC GGCACGGAAATTCCTCCGGTTGATHGNC: 21976335428[14]
COL3A1CTGGACCAAAAGGTGATGCT CAGGGTTTCCATCTCTTCCAHGNC: 22015635291[14]
FABP4ACCAGGAAAGTGGCTGGCAT CAGGTCAACGTCCCTTGGCTHGNC: 35595835331[16]
CEBPACGGTGGACAAGAACAGCAAC CGGAATCTCCTAGTCCTGGCHGNC: 18335835365[16]
PPARGGCTGTTATGGGTGAAACTCTG ATAAGGTGGAGATGCAGGTTCHGNC: 92365535351[15]
ADIPOQAGCCTCCTTCTCCTGGGTCC GTTGCCTCTAGCCTGGTGGGHGNC: 136335835295[16]
LPLGAGATTTCTCTGTATGGCACC CTGCAAATGAGACACTTTCTCHGNC: 66775035276[16]
GAPDHAGCCGCATCTTCTTTTGCGTC TCATATTTGGCAGGTTTTTCTHGNC: 41415528816[15]