Table 1: qRT-PCR primer sequences.

GeneForward sequenceReverse sequence

ACCAACATCCCCACGCTAAACAGCTGACAAGGTGGCGTGAAG
CPT-1AGTGGCCTCACAGACTCCAGGCCATGTTGTACAGCTTCC
CyclophilinATGTGGTTTTCGGCAAAGTTTGACATCCTTCAGTGGCTTG
FASCCCTTGATGAAGAGGGATCAGAACAAGGCGTTAGGGTTGA
IL-1βTCACAGCAGCACATCAACAATGTCCTCATCCTGGAAGGTC
IL-6ACCAGAGGAAATTTTCAATAGGCTGATGCACTTGCAGAAAACA
PGC-1αATGTGTCGCCTTCTTGCTCTATCTACTGCCTGGGGACCTT
PPAR-αCAGTGGGGAGAGAGGACAGAAGTTCGGGAACAAGACGTTG
PPAR-γGATGGAAGACCACTCGCATTAACCATTGGGTCAGCTCTTG
SCD-1GCTGGGCAGGAACTAGTGAGGAAGGCATGGAAGGTTCAAA
SREBP-1cATCTCCTAGAGCGAGCGTTGTATTTAGCAACTGCAGATATCCAAG
TFAMTCCAAGCCTCATTTACAAGCCCAAAAAGACCTCGTTCAGC
TGF-βAAGTTGGCATGGTAGCCCTTGCCCTGGATACCAACTATTGC
TNF-αATGGGCTTTCCGAATTCACGAGGCAACCTGACCACTCTC