Table 1: Oligonucleotide sequences for real-time PCR.

GeneSequence 53

ERK5 (human)CTGGCTGTCCAGATGTGAA
ATGGCACCATCTTTCTTTGG
MEF2C (human)TACAACGAGCCGCATGAGAG
CCTGTGTTACCTGCACTTGG
KLF2 (human)GCACGCACACAGGTGAGAAG
ACCAGTCACAGTTTGGGAGGG
VEGF (human)GGCCTCCGAAACCATGAACTTTCTGCT
GCATGCCCTCCTGCCCGGCTCACCGC
VEGF (rat)CTGCTGTCTTGGGTGCATTGG
CACCGCCTTGGCTTGTCACAT
β-actin
(human and rat)
CCTCTATGCCAACACAGTGC
CATCGTACTCCTGCTTGCTG
18S (human and rat)GTAACCCGTTGAACCCCATT
CCATCCAACGGTAGTAGCG