Table 2: The 14 selected genes for validation of gene expression and qPCR primer sequences.

GeneGO descriptionForward primer (5′–3′)Reverse primer (5′–3′)

1MRPS22Organellar ribosomeGAACTGAAGCCACCAACCTATAAGGCTGCCTCAACTGCCTGTC
2MRPL42Organellar ribosomeTCCAGTCCAAAATGGAGCTTCCACAGAAGGGTGGTAGCAT
3MRPL47Organellar ribosomeACCTGGTGCTTGGAGAAGAGACCACATAAGGCAAGGCAAAGAATCG
4MRPL21Organellar ribosomeGAGCCGAGATAGCTTCCTGACTCCTTCCCATTGGTTCTCA
5MRPL7Organellar ribosomeACGCTTTGATTGCTCGATCTTTGCCTCTTTGAAGCGTTTT
6MRPL10Organellar ribosomeGCAGAACAAGGAGCATGTGATTTCAGCCACCATGTCTTCA
7MRPL17Organellar ribosomeCACTCGTGAAACTGCTCAGGCGTCGGAATGGTACACACTG
8NDUFS1Hydrogen ion transporter activityTGCCCTAACCTCTAAGCCCTATGACTTCCAACCGCATCCATTACATC
9NOX1Hydrogen ion transporter activityGCCTCCATTCTCTCCAGCCTATCCACATACTCCACTGTCGTGTTTCG
10ACADMMitochondrialAGCCTTTACTGGATTCATTGTGGATTCCTCTAGTATCTGAACATCGC
11HSPD1Prefoldin complexTACTGGCTCCTCATCTCACTCGTGCTCAATAATCACTGTTCTTCCC
12PSMF1Prefoldin complexAACACCTGGGTGACTTCCACCCCACTGCTCATGGATAGGT
13PSMB9Prefoldin complexCGGGCGGGAGCACCAACCGCAGACACTCGGGAATCAGAACC
14PSMD10Prefoldin complexAGGTGCTCAAGTGAATGCTGTCTGTAGCCTCATAATGGTCCTTAGC