Research Article
New Quantitative Method to Identify NPM1 Mutations in Acute Myeloid Leukaemia
Table 1
Sequences of the different primers and probes.
| Gene analysis | Mutations (nucleotides insertion) | Primer | Sequence | Reference |
| NPM1 HRM analysis | — | NPM-S (F) | 5′ TGGTTCCTTAACCACATTTCTTT 3′ | [18] | — | NPM-AS (R) | 5′ GGACAACACATTCTTGGC 3′ | — |
| NPM1 ASO-RQ-PCR | — | c-NPMl-F (F) | 5′ GAAGAATTGCTTCCGGATGACT 3′ | [11] | A (tag) | c-NPM-mut A-R (R) | 5′ CTTCCTCCACTGCCAGACAGA 3′ | [11] | B (catg) | c-NPM-mut B-R (R) | 5′ TTCCTCCACTGCCATGCAG 3′ | [11] | C (cctg) | c-NPM-mut C-R (R) | 5′ TTCCTCCACTGCCACGCAG 3′ | [12]* | D (cctg) | c-NPM-mut D-R (R) | 5′ TTCCTCCACTGCCAGGCAG 3′ | [12]* | P (cttg) | c-NPM-mut P-R (R) | 5′ TTCCTCCACTGCCAAGCA 3′ | [12]* | — | NPM1 Detection Probe | 5′ Fam-ACCAAGAGGCTATTCAA-MGB 3′ | [11] |
| ABL ASO-RQ-PCR | — | ENF1003 (F) | 5′ TGGAGATAACACTCTAAGCATAACTAAAGGT 3′ | [19] | — | ENR1063 (R) | 5′ GATGTAGTTGCTTGGGACCCA 3′ | [19] | — | ENPrl043 detection probe | 5′ Fam-CCATTTTTGGTTTGGGCTTCACACCATT-Tamra 3′ | [19] |
|
|
F: forward primer; R: reverse primer; specific mutation primers were designed based on mutations previously described by Schnittger et al. [12].
|