Table 1: Primers of real-time PCR the chicken β-actin and CAPN 2 gene.

GenePrimer sequence (5’–3’)Tm (°C)

β-actinF: GCCAACAGAGAGAAGATGACAC60
R: GTAACACCATCACCAGAGTCCA
CAPN2F: TAGACCTACGGAGCTGTGTTCCT60
R: TTCAGAGTGAGGGAGGCAATAG

Tm: annealing temperature.