Table 2: Primers for targeted genes.

GeneGenBank Accession no.Sequence (5′ to 3′)Size (bp)Annealing temp. (°C)

Human nesfatinNM 005013.2GCATGGACCACCAAGCTCTTCTAA11762
GTTCCAGATCACTTGTTGCCGCTTT

Human 18S rRNANR 003286GACTCAACACGGGAAACCTCAC12262
CCAGACAAATCGCTCCACCAAC