Table 1: Real-time qPCR primers.

F4-80 forwardCTTTGGCTATGGGCTTCCAGTC
F4-80 reverseGCAAGGAGGACAGAGTTTATCGTG
CD11c forwardCTGGATAGCCTTTCTTCTGCTG
CD11c reverseGCACACTGTGTCCGAACTC
CD163 forwardGGGTCATTCAGAGGCACACTG
CD163 reverseCTGGCTGTCCTGTCAAGGCT
IL-6 forwardGAGGATACCACTCCCAACAGACC
IL-6 reverseAAGTGCATCATCGTTGTTCATACA
KC forwardTCTCCGTTACTTGGGGACAC
KC reverseCCACACTCAAGAATGGTCGC
MCP-1 forwardATTGGGATCATCTTGCTGGT
MCP-1 reverseCCTGCTGTTCACAGTTGCC
MIP-1α forwardGTGGAATCTTCCGGCTGTAG
MIP-1α reverseACCATGACACTCTGCAACCA
PAI-1 forwardGCCAGGGTTGCACTAAACAT
PAI-1 reverseGCCTCCTCATCCTGCCTAA
TNF-α forwardCATCTTCTCAAAATTCGAGTGACAA
TNF-α reverseTGGGAGTAGACAAGGTACAACCC

Quantitative real-time PCR primer sequences used in evaluation of expression.