Inhibition of Mitochondrial Cytochrome c Release and Suppression of Caspases by Gamma-Tocotrienol Prevent Apoptosis and Delay Aging in Stress-Induced Premature Senescence of Skin Fibroblasts
Table 1
Gene definition
Gene symbol
Accession no.
Base pair sequences (RefSeq)
PCR product size (bp)
Homo sapiens BCL2-associated X protein, transcript variant alpha, and mRNA
BAX
NM_138761
F: 5′acgaactggacagtaacatggag 3′
R: 5′cagtttgctggcaaagtagaaaag 3′
158 bp
Homo sapiens BH3 interacting domain death agonist, transcript variant 1, and mRNA
BID
NM_197966
F: 5′tgtgaaccaggagtgagtcg 3′
R: 5′ctttggaggaagccaaacac 3′
122 bp
Homo sapiens BCL2-related protein A1, transcript variant 1, and mRNA