Table 1

Gene definitionGene symbolAccession no.Base pair sequences
(RefSeq)
PCR product size (bp)

Homo sapiens BCL2-associated X protein, transcript variant alpha, and mRNABAXNM_138761F: 5acgaactggacagtaacatggag 3
R: 5cagtttgctggcaaagtagaaaag 3 158 bp
Homo sapiens BH3 interacting domain death agonist, transcript variant 1, and mRNABIDNM_197966 F: 5tgtgaaccaggagtgagtcg 3
R: 5ctttggaggaagccaaacac 3 122 bp
Homo sapiens BCL2-related protein A1, transcript variant 1, and mRNABCL2A1NM_004049 F: 5tccaaaaagaagtggaaaagaatc 3
R: 5gctgtcgtagaagtttcttgatga 3 189 bp
BCL2-like 1 nuclear gene encoding mitochondrial protein, transcript variant 1, and mRNABCL2L1NM_138578 F: 5gcatatcagagctttgaacaggt 3
R: 5taggtggtcattcaggtaagtgg 3 180 bp
Glyceraldehyde-3- phosphate dehydrogenase, and mRNA GAPDH BC_020308 F: ccaagatgccacagatgattg
R: actccttgggtccacctggta 217 bp