Genome-Wide Transcriptional Analysis Reveals the Protection against Hypoxia-Induced Oxidative Injury in the Intestine of Tibetans via the Inhibition of GRB2/EGFR/PTPN11 Pathways

Table 2

The primers used for real-time quantitative PCR.

Genes	GenBank accession number		Primers (5′-3′)	Size (bp)
EGFR	BC094761.1	Forward	accatccaggaggtggctgg	440
		Reverse	ggatcacacttttgtccctg
GBR2	JX512444.1	Forward	aagacggcttcattcccaag	134
		Reverse	ctctctcggataagaaaggc
PTPN11	NM_002834.3	Forward	ttcacactttccgttagaag	162
		Reverse	attgcccgtgatgttccatg

Note: epidermal growth factor receptor (EGFR), growth factor receptor-bound protein 2 (GRB2), and tyrosine-protein phosphatase nonreceptor type 11 (PTPN11).