Table 3: Characteristics of primer pairs used, amplicon length, and efficiency of reaction in the RT-qPCR.

Accession#GenePrimer sequence (5′ to 3′)Product length (bp)Efficiency

JN236219.1ACACA Forward: CTCCAACCTCAACCACTACGG
Reversal: GGGGAATCACAGAAGCAGCC
1712.09
JI861797.1AGPAT6 Forward: AAGCAAGTTGCCCATCCTCA
Reversal: AAACTGTGGCTCCAATTTCGA
1012.17
X91503#CD36 Forward: GTACAGATGCAGCCTCATTTCC
Reversal: TGGACCTGCAAATATCAGAGGA
812.18
DQ380249.1DGAT1 Forward: CCACTGGGACCTGAGGTGTC
Reversal: GCATCACCACACACCAATTCA
1012.11
NM_001009350FABP3 Forward: GATGAGACCACGGCAGATG
Reversal: GTCAACTATTTCCCGCACAAG
1202.14
DQ915966.3FASN Forward: GGGCTCCACCACCGTGTTCCA
Reversal: GCTCTGCTGGGCCTGCAGCTG
2262.13
AJ431207GAPDH Forward: GCAAGTTCCACGGCACAG
Reversal: GGTTCACGCCCATCACAA
2492.16
DQ997818LPL Forward: AGGACACTTGCCACCTCATTC
Reversal: TTGGAGTCTGGTTCCCTCTTGTA
1692.18
GU332719NR1H3 Forward: CATCAACCCCATCTTCGAGTT
Reversal: CAGGGCCTCCACATATGTGT
1632.13
HQ846826PLIN2 Forward: TACGATGATACAGATGAATCCCAC
Reversal: CAGCATTGCGAAGCACAGAGT
2032.16
HQ846827PLIN3 Forward: GGTGGAGGGTCAGGAGAAA
Reversal: TCACGGAACATGGCGAGT
1701.13
GQ918145PNPLA2 Forward: GGAGCTTATCCAGGCCAATG
Reversal: TGCGGGCAGATGTCACTCT
2262.24
HQ589347.1PPARG Forward: CCTTCACCACCGTTGACTTCT
Reversal: GATACAGGCTCCACTTTGATTGC
1452.21
DV935188#SCAP Forward: CCATGTGCACTTCAAGGAGGA
Reversal: TGTCGATCTTGCGTGTGGAG
1082.10
GU947654SCD Forward: CCATCGCCTGTGGAGTCAC
Reversal: GTCGGATAAATCTAGCGTAGCA
2572.10
HM443643.1SREBF1 Forward: CTGCTGACCGACATAGAAGACAT
Reversal: GTAGGGCGGGTCAAACAGG
812.20

Annealing temperature for all primers in this table is 60°C.
ACACA, acetyl-coenzyme A carboxylase alpha; AGPAT6, 1-acylglycerol-3-phosphate O-acyltransferase 6; CD36, thrombospondin receptor; DGAT1, diacylglycerol acyl transferase 1; FABP3, fatty acid binding protein 3; FASN, fatty acid synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LPL, Lipoprotein lipase; NR1H3, liver X receptor α; PLIN2, perilipin2; PLIN3, perilipin3; PNPLA2, patatin-like phospholipase domain containing 2; PPARG, peroxisome proliferator-activated receptor γ ; SCAP, cleavage activating protein; SCD, stearoyl-CoA desaturase; SREBF1, Sterol regulatory element-binding transcription factor 1.
#The primer sequences are from bovine.