About this Journal Submit a Manuscript Table of Contents
Sarcoma
Volume 2012 (2012), Article ID 498472, 11 pages
http://dx.doi.org/10.1155/2012/498472
Research Article

DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

1Department of Quality Control, XBiotech, Inc., Austin, TX 78744, USA
2Department of Pathology, Vanderbilt University, Nashville, TN 37232, USA
3Department of Biostatistics, Vanderbilt University, Nashville, TN 37232, USA
4Division of Clinical Research, Fred Hutchinson Cancer Research Center, Seattle, WA 98109, USA
5Department of Pathology, University of Washington School of Medicine, Seattle, WA 98195, USA
6Department of Medicine, University of Washington School of Medicine, Seattle, WA 98109, USA
7Department of Pediatrics and Pathology, University of Michigan, Ann Arbor, MI 48109, USA
8Division of Pediatric Hematology-Oncology, Department of Pediatrics, Vanderbilt University, Nashville, TN 37232-6510, USA

Received 23 April 2012; Accepted 14 July 2012

Academic Editor: Maria Tsokos

Copyright © 2012 Nikul Patel et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Supplementary Material

Supplementary Figure S1: Flow diagram of pathology samples analyzed by methylation analysis.

Supplementary Figure S2: Bisulfite treated DNA was PCR amplified with TNFRSF10A, IGFBP7, PDGFBR, SNURF, and RUNX3 bisulfite sequencing primers designed with MethPrimer (11). PCR conditions were as follows: 95° × 15’; (94° × 30”; 55° × 30”; 72° × 30”) × 35 cycles; 72° × 10’. PCR amplicons were cloned into a TA vector (Life Technologies, Carlsbad, CA), transformed, subjected to DNA extraction (plasmid mini-prep kit, Qiagen, Valencia, CA) and sequenced. Sequencing was performed either on an ABI 3730xl DNA Analyzer. Sequencing data was analyzed using BiQ software (12). Percent methylation was calculated by dividing the total number of methylated CpGs in for each gene/tissue analyzed by the total number of CpGs investigated.

Supplementary Figure S3: A.) Schematic diagram describing treatment of EWS cell lines. B.) Venn diagram demonstrating the overlap of genes upregulated > 2-fold upon treatment of 5-AZA.

Supplementary Figure S4: A.) Optimal 5-AZA dosing for cell lines SK-ES-1 and SK-N-MC were determined experimentally to minimize cell death while still resulting in a greater than 2 fold increase in RASSF1A expression as determined by qRT-PCR. 5-AZA treatment, RNA isolation, and cDNA synthesis was performed as described in Materials and Methods. qRT-PCR for RASSF1A was performed using TaqMan Assay # Hs00200394, (Life Technologies, Carlsbad, CA) on a Step One Plus thermocycler (Life Technologies, Carlsbad, CA) or Opticon 2 thermocycler (Bio-Rad, Hercules, CA) in triplicate and normalized using GUSB expression (Assay # Hs99999908). Relative expression was calculated using the comparative CT method (∆∆CT). Each assay was repeated three times and error bars were generated by calculation of the standard error of the mean. Error bars demonstrating the standard error of the mean (SEM) are shown. B.) qRT-PCR of CALCA was performed using TaqMan technology (Assay # Hs01100741, Life Technologies, Carlsbad, CA) as described above.

Supplementary Figure S5: A.) Schematic representing RASSF1A locus showing location of MSP primers, bisulfite sequencing primers, and bead chip CpG. Tss = transcription start site. B.) Bisulfite sequencing analysis of EWS cell lines. Bisulfite sequencing primers were designed using MethPrimer (F: 5’ GTAGTTTAATGAGTTTAGGTTTTTT 3’; R: 5’ ATCCCTACACCCAAATTTCCATTAC 3’). Filled lollipops denote methylated CpGs; empty lollipops denote unmethylated CpGs. C.) MSP analysis of EWS cell lines A673, SK-ES-1 (ES-1), and SK-N-MC (N-MC), and hMSC cell line HS-27a (27a) were determined using primers designed for methylated (F: 5’ GGGTTTTGCGAGAGCGCG 3’; R: 5’ GCTAACAAACGCGAACCG 3’) and unmethylated (F:5’ GGTTTTGTGAGAGTGTGTTTAG 3’; R: 5’ CACTAACAAACACAAACCAAAC 3’ ) RASSF1A. Positive (SssI treated DNA) and negative controls (WGA amplified DNA) are shown. M= methylated; U= unmethylated D.) RASSF1A methylation comparison of EWS primary tumors and cell lines.

Supplementary Table S1: Patient Demographics.

Supplementary Table S2: Raw Methylation Data after Statistical Analysis.

  1. Supplementary Figure S1
  2. Supplementary Figure S2
  3. Supplementary Figure S3
  4. Supplementary Figure S4
  5. Supplementary Figure S5
  6. Supplementary Table S1
  7. Supplementary Table S2