Table 1: Primer Sequences.

GenePrimer sequenceBand size (bp)

GAPDH Forward: TCCATGACAACTTTGGCATTG103
Reverse: TCACGCCACAGCTTTCCA
BMP2Forward: TCTTCCGGGAACAGATACAGG126
Reverse: TGGTGTCCAATAGTCTGGTCA
BMP4Forward: ATTCCTGGTAACCGAATGCTG89
Reverse: CCGGTCTCAGGTATCAAACTAGC
VEGFForward: GCCAGACAGGGTTGCCATAC 108
Reverse: GGAGTGGGATGGATGATGTCAG
c-MycForward: TGACCTAACTCGAGGAGGAGCTGGAATC170
Reverse: AAGTTTGAGGCAGTTAAAATTATGGCTGAAGC
ALDHForward: GACAGGCTTTCCAGATTGGCTC142
Reverse: AAGACTTTCCCACCATTGAGTGC
mTORForward: CAGTTCGCCAGTGGACTGAAG130
Reverse: GCTGGTCATAGAAGCGAGTAGAC