Table 3: Primer information.

Primer nameTarget geneRegionaForward (5′ 3′)Reverse (5′ 3′)

pAL7invGAGCAAAAGGCCAGCAAAAGAACCGTATTACCGCCTTTGA
GFPORFATGGGCGTGATCAAGCCCGTTAGCCGGCCTGGCGGGGT
dhc1upSPAC1093.06c/dhc1 −1044AAGCACGCGCTCTAATTCATGGTGTCAAGAAAACTTGACCG
dhc1dw+958AACTTGAAACTATTTGTTGTTTACTAGAATCTGAGGTTGATGTTGAA
mam2upSPAC11H11.04/mam2 −1068CATCGGGATTGCATTGAGAGTAATGTCAGAGGGAGCAAGAACA
mam2dw+1010CTTACGCCTGAATGTATCTTTACTCAAAGCCATAACTGTGC
mam3upSPAP11E10.02c/mam3 −1041TTTTAGAAAGTGTCTATTGTACCGACGAATTATGGGAAGATCAAG
mam3dw+997ATAAAGTTAATGTTTTATATTTATTTTACAACTGAGAATGTCGTCTGTCC
rgs1upSPAC22F3.12c/rgs1 −1118GGCAGGTGTAAGAAGCGTTGCCAAAGCTGATTCTTACTTTTACGA
rgs1dw+944TGCATAGAAAACAATCGTGTCGAAAGAATCCTGCTGTTAC
SPBC4.01upSPBC4.01−985CCCATCTGGGTGAAAGAGTGCCATTCTTAAACCGTAATTTTAAATTG
SPBC4.01dw+992ACAAACATAAATAAGATTTTGTAAACAATTATTGCTGTCGCCGAAC
spk1upSPAC31G5.09c/spk1 −1040GGACGCCAAGGGAAATTTATTAGACTACAAATTGAAAAACTTGAAAG
spk1dw+958AAAGCTTCAACTAGAATTCTCCTCAACCGATGACGGTATTTAT
sxa2upSPAC1296.03c/sxa2 −1363AGATTATGGGGTAGTGGGTTCGCATTGAAAAGAGAGACAATGA
sxa2dw+945AAGTTTAATATCGGAAAATTTAACGGAAGTTAGGCTTGTGTGC

aRegion represents how distant from ATG or stop codon of its target gene is ORF.