Table 1: Primers used for RT-PCR.

Construct namePrimer namePrimer sequence

Histone H3 (His-tag)HistoneH3fwCACCATGGCTCGTACCAA
HistoneH3reTTACAATCTTATGGTTCTAATCAAA

HCS1 (GST-tag)HCSFWGGGAATTCATGTTGTTTCTCATTTCTT
HCSREGGCTCGAGTCATATTTTTCTTCGA