Abstract
Reactive oxygen species (ROS) contribute to cancer growth and metastasis. Using antioxidants to modulate cellular ROS levels is a promisingstrategy for cancer prevention and treatment. Calophyllum inophyllum L., or tamanu, is a medicinal plant renowned for its anti-inflammatory, antioxidant, and anticancer properties in traditional medicine systems. However, the anticancer effects of C. inophyllum extract on cellular ROS remain unexplored. This study represents the first report on such effects and provides the potential mechanisms underlying the anticancer properties of C. inophyllum extract. The branches of C. inophyllum were extracted, and the extract was comprehensively analyzed for phytochemical constituents, antioxidant capacity, total phenolic content, and total flavonoid content. Subsequently, the extract’s potential anticancer properties were evaluated using patient-derived cells from breast and lung cancer. The results revealed that the C. inophyllum extract possesses notable antioxidant activity and demonstrated no cytotoxicity within the initial 24 h of treatment. However, after 72 h, it exhibited significant antiproliferative effects. Moreover, the extract exhibited inhibitory properties against migration and invasion at concentrations below the IC50, which corresponded to the expression of related genes. Notably, these effects correlated with the reduction of intracellular ROS levels. Overall, our findings highlight the anticancer potential of C. inophyllum extract, emphasize its ability to modulate cellular ROS levels and target key molecular pathways involved in cancer progression. This study sheds light on the promising therapeutic implications of C. inophyllum extract as a novel agent for cancer treatment, which is safe for normal cells.
1. Introduction
Reactive oxygen species (ROS) play many crucial roles in cancer progression and metastasis leading to the death of cancerous patients. As we have known for many decades that lung cancer in males and breast cancer in females are the leading causes of mortality worldwide [1]. ROS is accused of cancer death due to the involvement of cancer progression and metastasis including cell growth, proliferation, migration, and invasion by activating upstream-proliferative signaling cascades, growth factor receptors, adhesion molecules, and transcription factors [2]. Nevertheless, disrupting redox homeostasis in cancer cells by rapidly increasing intracellular ROS ultimately results in cell death which is a property of several FDA-approved drugs for cancer treatment including paclitaxel, 5-fluorouracil, doxorubicin, and cisplatin [3]. These effective chemotherapies also result in serious side effects on surrounding normal cells by oxidative damage. Increasing the ROS level above the redox balance in cancer cells effectively kills the cells while the ROS level below that alleviates aggressiveness by deceleration of proliferation, metastasis, and cell death induction [4]. Reduction of intracellular ROS by antioxidants on ROS-dependent cancer cells enhanced the potential of success in the treatment of metastatic solid tumors demonstrated in either in vitro or in vivo models with promising results [5, 6]. In addition, numerous plant-derived phytochemicals, including polyphenols and flavonoids, exhibit the potential for antiproliferation and antimetastasis against cancer cells without causing cytotoxicity [5–7].
Calophyllum inophyllum L., commonly known as tamanu, is a tropical evergreen tree belonging to the family Calophyllaceae. It distributes across Thailand, especially in the coastal regions. With its medium-sized stature, reaching heights of 20–30 meters, it thrives in diverse landscapes, including forests, mangroves, coastal areas, and tropical regions [8, 9]. This plant has been recognized as one of the most important medicinal plants in Ayurvedic and Thai traditional medicine with various parts including leaves, flowers, and stem barks with medicinal properties [10]. The plant extract from various parts is rich in antioxidants identified as polyphenols, phenolic acids, flavonoids, and other antioxidant structuring phytochemicals which exhibit anti-inflammation, antimicrobial, and anticancer effects [8, 11, 12]. The phytochemicals obtained from the ethanolic leaf extract and oil seed of this plant have demonstrated cytotoxic effects on breast and lung cancer cells, leading to the induction of apoptosis [13, 14]. In addition, the extract from this plant was noncytotoxic to many noncancerous cells including keratinocytes, dermal fibroblasts [15], preosteoblasts [16], and conjunctival epithelial cells [17].
Despite its traditional use and documented properties, there is a significant knowledge gap in the scientific literature regarding the specific effects of C. inophyllum on cancer treatment and its relationship with intracellular ROS. Further research is needed to explore the potential anticancer effects of C. inophyllum extract and its modulation of ROS. With its potent antioxidant, anti-inflammatory, and anticancer properties, C. inophyllum presents an intriguing candidate for investigating cellular ROS modulation in cancer cells. Its ability to impact multiple pathways involved in cancer development makes C. inophyllum a promising subject for scientific inquiry.
The objectives of this study were to investigate the phytochemical properties of C. inophyllum extract and to elucidate the effects of the C. inophyllum extract on cancer cells derived from the patients in comparison with the cancer cell lines. While previous literature has extensively explored the therapeutic potential of various parts of C. inophyllum, the branches of the tree have received limited attention until now. The study assessed the biochemical properties of the C. inophyllum branch extract and identified its phytochemical constituents. It was hypothesized that using cancer cells derived from the patients might provide better outcomes due to the fact that they demonstrate characteristics of cancer tissues in the body which promptly respond to the extract.
2. Materials and Methods
2.1. Plant Materials
The fresh branches of C. inophyllum were collected from Chomphu Subdistrict, Mueang District, Lampang Province, Thailand, in February 2022. The plant was identified and authenticated by a taxonomist, Dr. Angkhana Inta, Department of Biology, Faculty of Science, Chiang Mai University, Thailand, and deposited at the Queen Sirikit Botanic Garden Herbarium (QBG), Thailand (voucher specimen no. 7885). The plant branches were stripped of all leaves, cut into small crumbs, air-dried in a hot air oven at 45°C for 7 days, and powdered using an electric blender. The obtained powder was stored in a light-protective glass bottle before further extraction procedures.
2.2. Extraction of Plant Materials
The ethanolic extract was prepared by macerating the 100 g dried powder with 70% ethanol for 72 h. The extracts were filtered using Whatman No. 1 filter paper (Whatman® Schleicher & Schuell, UK) and concentrated under reduced pressure at 45°C in a rotary evaporator (Buchi, Switzerland). Finally, the C. inophyllum extract was collected, weighed, calculated for its yield, and kept in a light-protected vial at 4°C for further experiments. For use, the extract was dissolved in the initial 70% ethanol.
2.3. Evaluation of Phytochemical Properties
2.3.1. DPPH Free Radical Scavenging Assay
The antioxidant activity of C. inophyllum extract was estimated in vitro based on the scavenging activity of the 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical, as described by Blois [18]. The stock solution of the extract was diluted in methanol and pipetted into each well of a 96-well plate. Then, the DPPH solution was added to each well and thoroughly mixed with the plate shaker. The mixture was further incubated in the dark at room temperature for 30 min. The optical density values at 517 nm were measured by using a microplate reader (Rayto, China). The percentage of DPPH free radical scavenging activity was calculated. The half-maximal inhibitory concentration (IC50) was calculated from the plotted equation. Ascorbic acid and quercetin were used as standard antioxidants and positive controls.
2.3.2. Total Phenolic Content
The total phenolic content of C. inophyllum extract was estimated by colorimetric assay, Folin–Ciocalteu’s reagent as described elsewhere [19]. In brief, 40 μl of the sample was pipetted into glass tubes, 800 μl 10% Folin–Ciocalteu’s reagent was topped up, and the mixture was well mixed and incubated at room temperature for 5 min. Then, 800 μl 7% sodium carbonate and 360 μl ultrapure water were added to each tube of the mixture followed by thorough mixing. The reaction mixture was incubated for 2 h in the dark at room temperature. The OD760 was measured using a UV-VIS spectrophotometer (Hitachi, Japan). The OD760 values of quercetin were plotted to obtain the calibration curve. Estimation of total phenolic content in C. inophyllum extract is exhibited as mg of gallic acid equivalent per gram dry extract (mg GAE/g DW) using the calibration curve of gallic acid.
2.3.3. Total Flavonoid Content
Total flavonoid content of the C. inophyllum extract was assessed by the aluminum chloride colorimetric assay as described previously [20]. 0.2 ml of either C. inophyllum extract or standard was mixed with 4.8 ml of ultrapure water in a test tube. 0.3 ml of 5% NaNO2 was topped up and mixed well by using a vortex mixer. After that, the mixture was left at room temperature for 5 min prior to the addition of 0.3 ml of 10% AlCl3 6H2O as well as 2 ml of 1 M NaOH solution into each tube. The ultrapure water was dispensed to reach the final volume of 10 ml. The optical density values at 415 nm were recorded using a UV-VIS spectrophotometer (Hitachi, Japan). Quercetin was used as a standard. The total flavonoid content was expressed as mg of quercetin equivalents per gram of dry extract (mg QE/g DW) using the calibration curve of quercetin.
2.3.4. Gas Chromatography-Mass Spectrophotometry Analysis
In order to identify certain phytochemical constituents as well as to illustrate the chromatogram fingerprint in the C. inophyllum extract, GC-MS analysis was performed using Agilent Technologies GC-MS 7890A/5975C Series (Agilent, USA) equipped with a capillary column (30 m in length × 0.25 mm in diameter × 0.25 μm film thickness) (partly modified from Kadir [21]). The spectrum database reported in the W08N08 library (John Wiley & Sons, Inc., USA) was used to identify the phytochemical components of the extract. The identified phytochemicals were examined using PubChem (https://pubchem.ncbi.nlm.nih.gov/).
2.4. Cancer Tissue Collection, Establishment, and Culture of Patient-Derived Cells
Biological waste cancer tissues were collected from 6 anonymous patients after surgery by physicians. All processes were approved by the Research Ethics Committee, Faculty of Medicine Chiang Mai University (EXEMPTION 8600/2021). The samples were stored in a transport medium (Dulbecco’s modified Eagle medium (DMEM) + 5% fetal bovine serum (FBS) + 1X antibiotics-antimycotics) on ice and subjected for cell outgrowth preparation. After rinsing with sterile phosphate buffer saline (PBS) containing 1X antibiotics-antimycotics, the tissues were minced plated onto a culture flask (Nunc™; Thermo Fisher Scientific, USA) filled with complete medium (20% FBS in DMEM+1X antibiotics-antimycotics). The flasks were incubated in a CO2 incubator at 37°C till the outgrowth cells reached 50% confluence. Then, subculture was performed and continued maintaining the cells with DMEM supplemented with 1X antibiotics-antimycotics and 10% FBS. These cells were called patient-derived cells (PDCs), which were derived from breast and lung cancers, abbreviated as BC and LC, respectively.
2.5. Ki-67 Immunocytochemistry for Cancer Cell Characterization
This experiment aimed to determine whether the PDCs possess characteristics of cancer cells by assessing their proliferation capability using the cancer proliferation marker, Ki-67. The expression of Ki-67 was examined in the PDCs and compared to that of standard cancer cell lines, serving as a reference. After the 24-hour culture, the cells were fixed with an ice-cold 4% paraformaldehyde (Sigma, USA) for 15 min. The fixed cells were rinsed with PBS and permeabilized with 0.25% Triton-X at room temperature for 20 min. The permeabilized cells were washed with PBS prior to submerging them into a blocking solution containing 10% bovine serum albumin (Sigma, USA) at room temperature for 30 min. Primary antibody of Ki-67 (1 : 5,000) (Thermo Fisher Scientific, USA) was applied to the cell overnight at 4°C. After a thorough wash with PBS, the diluted peroxidase-conjugated secondary antibody (1 : 2,000) (Elabscience, USA) was applied, and DAB substrate (3,3′-diaminobenzidine tetrahydrochloride) (Elabscience, USA) was added. The cells were then counterstained with hematoxylin (Sigma, USA). The stained cells were photographed under a microscope, and the number of positive nuclei was counted and used to calculate the mean percentage of positive cells.
2.6. Cell Lines and Culture Conditions
Two lines of human lung carcinoma cells (A549 and NCI-H1299), two lines of breast carcinoma cells (MCF-7 and MDA-MB-231), and a noncancerous normal human lung fibroblast (IMR-90) were used in this research. All cell lines were purchased from American Type Culture Collection (USA). A549 and IMR-90 were cultured and propagated in DMEM, whilst NCI-H1299 was in RPMI 1640. The complete medium was supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% FBS. All cells were maintained under a standard cell culture condition at 37°C in an atmosphere consisting of 5% CO2.
2.7. Evaluation of C. inophyllum Extract on Cancer Bioactivities
2.7.1. Effects on Cytotoxic and Antiproliferation
To determine whether C. inophyllum extract had cytotoxicity and antiproliferative effects on cancer cells, a sulforhodamine B colorimetric assay was applied. After seeding cells into each well of a 96-well culture plate and incubating for 24 h, the cells were exposed to the complete medium containing various concentrations of C. inophyllum extracts for 24 and 72 h, along with quercetin. The assessment of cell viability was performed using the sulforhodamine B colorimetric assay, as described by Vichai and Kirtikara [22]. In brief, cells were fixed with 10% trichloroacetic acid and incubated with 0.057% sulforhodamine B solution (Sigma, USA) at room temperature for 30 min. After washing with 1% acetic acid (Sigma, USA), the dye was solubilized with 10 mM tris solution (pH 10.5) (Sigma, USA) with constant agitation for 15 min. The optical density values at 510 nm were read by a microplate reader (Rayto, China) and the IC50 of the extract was determined by using PriProbit Program ver. 1.63 [23]. The criteria for cytotoxicity were adhered to when the IC50 value was higher than 20 μg/ml [24]. In addition, selectivity index values were calculated by dividing the IC50 values of the normal cell line by the IC50 values of the cancer cells. A selectivity index higher than 1.00 indicates specificity towards cancer cells [25]. The IMR-90 cell line was used as the normal cell line in this experiment.
2.7.2. Effects on Cell Migration
To assess the inhibitory effects of the C. inophyllum extract on cancer cell migration, a migration assay was employed. After the cells reached 75% confluence and formed a monolayer, the cell layers were scratched with a sterile pipette tip and washed with PBS. The complete medium containing C. inophyllum extract and reference compound was then added to the scratched cell layer prior to the incubation under the standard culture condition. Gap closure was monitored and photomicrographed after 24 h using an Optika IM-3 inverted microscope equipped with a C-B10+ digital camera (Optika, Italy) in comparison with 0 h of incubation. The gap distances were measured using ImageJ software (NIH, USA), and the results were expressed as percentages of the gap distance in the treatment group relative to the gap distance in the untreated control at 0 h.
2.7.3. Effects on Cell Invasion
To investigate the potential inhibitory effects of C. inophyllum extract on cancer cell invasion, a Transwell insert coated with Matrigel® was utilized. The invasion assay was performed in 24-well Corning® Biocoat® Matrigel® invasion chambers (Corning, USA) with a membrane pore size of 8 μm. According to the manufacturer’s instructions, the chambers were rehydrated and prewarmed by adding 37°C PBS in each chamber containing the Matrigel® insert (upper chamber) and incubated at 37°C for 2 h. Cells were plated onto the insert supplemented with the complete medium containing C. inophyllum extract or a reference substance. The lower chamber was filled with a medium containing 20% FBS as a chemoattractant. After 24 h, the inserts were fixed in 4% paraformaldehyde and stained with 0.1% crystal violet solution (Sigma, USA). The invaded cells on the lower surface of the inserts were photographed and counted. The complete medium supplemented with 10% FBS was used as a negative control. The results were quantified as the percentage of invaded cells, calculated by multiplying the ratio of cell numbers in the treatment group to the cell numbers in the negative control by 100.
2.7.4. Effects on Intracellular Reactive Oxygen Species (ROS) Modulation
To determine intracellular levels of ROS in the form of hydrogen peroxide (H2O2) and superoxide anions (O2·−), 2,7-dichlorodihydrofluorescein diacetate (DCFDA) was applied. After seeding the cells and incubating them in standard culture conditions for 24 h, the cells were exposed to the complete medium containing either the C. inophyllum extract, the reference compound, or 100 μM tert-butyl hydroperoxide (TBHP, a ROS-inducing standard compound) [26]. Intracellular ROS determination was conducted after 24 h of exposure to the targeted substances using the DCFDA/H2DCFDA—Cellular ROS Assay Kit (Abcam, UK). According to the manufacturer’s instructions, the medium was discarded, and the cells were rinsed with PBS and with 1X reaction buffer. 1X DCFDA solution was dropped onto the cell surface and incubated at 37°C for 45 min in the dark. The cells were rinsed with PBS prior to the observation under a fluorescence microscope (Olympus, Japan). Fluorescence intensity was measured by using ImageJ software (NIH, USA) through digital photomicrographs. The data were represented as the percentages of fluorescence intensity in comparison to the negative control, untreated cells.
2.7.5. Effects on Gene Expression
To confirm the effects of C. inophyllum extract on the inhibition of cancer cell migration, invasion, and ROS modulation, quantitative real-time PCR was used to quantify the expression levels of certain genes involved in the abovementioned processes. mRNA from the cells exposed to the C. inophyllum extract or quercetin for 24 h was harvested using NucleoSpin® RNA/Protein isolation (Macherey-Nagel™, Germany). Total cDNA was subsequently synthesized by using ReverTra Ace™ qPCR RT Master Mix (Toyobo, Japan). The expression of the candidate genes involved in cell migration (E-cadherin and Twist-1), invasion (MMP-2 and MMP-9), and ROS responsive (NRF2 and HIF-1α) were evaluated. The primer sequences of the gene were as follows: E-cadherin (forward primer 5′- AGCGAGTGGATGCCGCCTTTAA -3′ and reverse primer 5′- CATTCCAGGCATCTGCGATGAG -3′), Twist-1 (forward primer 5′- GCCAGGTACATCGACTTCCTCT -3′ and reverse primer 5′- TCCATCCTCCAGACCGAGAAGG -3′) [27], MMP-2 (forward primer 5′- AGCGAGTGGATGCCGCCTTTAA -3′ and reverse primer 5′- CATTCCAGGCATCTGCGATGAG -3′), MMP-9 (forward primer 5′- GCCACTACTGTGCCTTTGAGTC -3′ and reverse primer 5′- CCCTCAGAGAATCGCCAGTACT -3′) [28], NRF2 (forward primer 5′- CACATCCAGTCAGAAACCAGTGG -3′ and reverse primer 5′- GGAATGTCTGCGCCAAAAGCTG -3′) [27], HIF-1α (forward primer 5′- TATGAGCCAGAAGAACTTTTAGGC -3′ and reverse primer 5′- CACCTCTTTTGGCAAGCATCCTG -3′) [29], and β-actin (forward primer 5′- CACCATTGGCAATGAGCGGTTC -3′, and reverse primer 5′- AGGTCTTTGCGGATGTCCACGT -3′) [28]. Quantitative real-time PCR was performed in Bioer Real Time PCR Linegene K Plus (Bioer, China) using Thunderbird® SYBR® qPCR Mix (Toyobo, Japan). β-actin was applied as a housekeeping gene. Untreated cells were used as a control. Fold changes of gene expression were calculated by the 2−ΔΔCt method [30].
2.8. Statistical Analysis
The data presented in this study are expressed as the mean ± standard deviation (SD) and were derived from five independent replicates of each treatment. The significant differences among groups were evaluated by ANOVA followed by the Tukey post hoc test with a confidence interval < 0.01.
3. Results
3.1. Extraction of Plant Materials
The extraction yield was approximately 9.06% viscous mass obtained from 100 g powder branches of C. inophyllum after 72 h of continuous extraction in ethanol.
3.2. Evaluation of Phytochemical Properties
3.2.1. DPPH Free Radical Scavenging Activity
The antioxidant activity of C. inophyllum extract was investigated by a DPPH free radical scavenging method. DPPH scavenging activity at IC50 of C. inophyllum extract was determined in comparison to ascorbic acid and quercetin by the linear equation method and the IC50 values of the C. inophyllum extract were the highest compared to ascorbic acid and quercetin (Table 1).
3.2.2. Total Phenolic and Flavonoid Contents
The total phenolic content and the total flavonoid content of the C. inophyllum extract were determined as 109.16 ± 1.21 mg GAE/g DW and 96.88 ± 0.89 mg QE/g DW, respectively.
3.2.3. GC-MS Analysis of C. inophyllum Extract
The GC-MS profile of the ethanolic extract of C. inophyllum is shown in Figure 1. The main constituents identified in the extract are reported in Table 2. Sixteen phytochemicals were identified (the quality index >80%). Most components were phenolic (approximately 31% of total identified compounds). Other components were classified as furoic acid esters, dihydropyranones, catechols, benzofurans, furans, fatty acids, fatty acid esters, isoquinolines, and xanthones. The three highest abundant phytochemicals found in the C. inophyllum extract were 5-hydroxymethylfurfural (5-HMF), antiarol, and syringol which were classified as furans, phenols, and phenols, respectively.
3.3. Cancer Tissue Collection, Establishment, and Culture of Patient-Derived Cells
Cancer biopsies were collected from patients (Table 3) and disaggregated to primary cancer cells. Cells were outgrown from the cancer tissue samples and subcultured to obtain PDCs of breast (BC-1, BC-2, and BC-3) and lung (LC-1, LC-2, and LC-3) cancer (Figure 2). All breast and lung cancer samples were diagnosed by the pathologists as invasive carcinoma and adenocarcinoma, respectively. Phenotypic heterogeneity of the populations was found in all BC and LC cells. Fibroblast-like cells were the dominant phenotype in most of the cells in the population, while mesenchymal-like and epithelial-like cells were in the minority.
3.4. Ki-67 Immunocytochemistry for Cancer Cell Characterization
Immunocytochemistry of Ki-67 was applied to BC and LC cells in comparison to A549 and MDA-MB-231. The positive cells expressed brown nuclei (Figure 3(a)) were randomly counted and calculated to the percentage of positive cells (Figure 3(b)). There were 2 groups categorized by the percentage of positive cells; (1) >70%; BC-3, LC-3, LC-1, and A549 and (2) >50%; BC-2, BC-1, LC-2, and MDA-MB-231 ( < 0.01). PDCs exhibited characteristics of cancer proliferation identical to cancer cell line, A549, and MDA-MB-231.
(a)
(b)
3.5. Evaluation of C. inophyllum Extract on Cancer Bioactivities
3.5.1. Effects on Cytotoxicity and Antiproliferation
The cytotoxicity and antiproliferative effects of the C. inophyllum extract were assessed by determining the IC50 values after exposing the cells to different concentrations of the extract for 24 and 72 h (Table 4). Quercetin, an antioxidant flavonoid, was applied as a positive control. At 24 h, the IC50 values from most of the C. inophyllum extract treatments were >1,000 μg/ml, except MCF-7. In contrast, the IC50 values of C. inophyllum extract at 72 h were <1,000 μg/ml in most of the cells, except the PDCs of breast cancer with IC50 values >1,000 μg/ml. Unlike C. inophyllum extract, IC50 values of quercetin treatments at 24 h were >1,000 μg/ml in all cancer cell lines while IC50 of PDCs and IMR-90 were <500 μg/ml. However, IC50 values at 72 h of quercetin against most cancer cells were more evident with values <200 μg/ml, except in A549 with a value >1,000 μg/ml.
Selectivity index of the C. inophyllum extract and quercetin was elucidated using the IC50 of the normal cell (IMR-90) and the IC50 of each treatment at each time point (Table 5). The acceptable SI value was >1.00 indicating the specificity of the compounds to cancer cells. The results revealed that both C. inophyllum extract and quercetin exhibited specificity towards most cancer cell types, not all cell types were affected by these substances.
Based on the obtained results, subsequent experiments were conducted using C. inophyllum extract at concentrations of 100 and 200 μg/ml, as well as quercetin at concentrations of 10 and 20 μg/ml. These concentrations were selected based on their demonstrated antioxidant capacity and nontoxicity to cells, as evidenced by the cell survival rate of 80% after 24 h of treatment.
3.5.2. Effects on Cell Migration
After treating the cells with C. inophyllum extract and quercetin in the migration assay, the gap distances were measured to assess their migratory ability. The results showed that both the C. inophyllum extract and quercetin treatments significantly closed the gap compared to the control group at 0 and 24 h (Figure 4(a)). In the photomicrographs, the white-dotted lines are used as guidelines to measure the gap distances between cell margins. The highest percentage of gap distance indicates the largest space observed between cell margins at 0 h (Figure 4(b)). After 24 h, the control group (Ctrl) displayed a significant decrease in the percentage of gap distance for all cells, suggesting cell migration and gap closure. However, the effects of C. inophyllum extract and quercetin treatments on gap distances varied depending on the cell types. At 200 μg/ml of C. inophyllum extract exhibited significant inhibition of cell migration in most cancer cell types, except for MDA-MB-231. However, the effects of the extract at 100 μg/ml were less pronounced, whilst quercetin at a concentration of 20 μg/ml demonstrated significant inhibition of cell migration in most cancer cell types. However, at a concentration of 10 μg/ml, quercetin showed less inhibitory ability, particularly in BC-1 and LC-1 cells. When comparing the effects of C. inophyllum extract to quercetin, the percentage of gap distance in the quercetin-treated cells indicated a greater potential for inhibiting cancer cell migration compared to the C. inophyllum extract across all cancer cell types.
(a)
(b)
3.5.3. Effects on Cell Invasion
The most effective concentrations of C. inophyllum extract and quercetin were found to be 200 and 20 μg/ml, respectively. Using these concentrations, the ability of the compounds to inhibit cancer cell invasion was tested using a Transwell insert with the Matrigel® model. Both the 200 μg/ml C. inophyllum extract and 20 μg/ml quercetin significantly inhibited cell invasion in all cancer cell types (Figure 5(a)). The results demonstrated a clear reduction in the number of invading cells compared to the controls for both the C. inophyllum extract and quercetin across all cancer cell types. Notably, quercetin treatments showed a greater potential to inhibit cancer cell invasion compared to the C. inophyllum extract, as observed by the percentage of invasion in the lower chamber (Figure 5(b)).
(a)
(b)
3.5.4. Effects on Intracellular ROS Modulation
After exposing the cells to 200 μg/ml of C. inophyllum extract or 20 μg/ml of quercetin for 24 h, the intracellular ROS levels were visualized in green using fluorescence microscopy (Figure 6(a)). tert-Butyl hydroperoxide (TBHP), a compound known to induce ROS production, was used as a positive control and successfully increased ROS levels in all cancer cell types. The treatments with C. inophyllum extract and quercetin significantly reduced intracellular ROS levels compared to the untreated controls in all cancer cell types (Figure 6(b)). Notably, in many cases, the C. inophyllum extract exhibited a greater ability to decrease ROS levels compared to quercetin, except in MCF-7, BC-1, BC-2, and LC-3 cells where both C. inophyllum extract and quercetin treatments showed similar potency.
(a)
(b)
3.5.5. Effects on Gene Expression
The results demonstrated that treatment with 200 μg/ml of C. inophyllum extract and 20 μg/ml of quercetin significantly decreased the expression of genes involved in cancer cell migration, invasion, and ROS modulation, with the exception of E-cadherin, which showed significant activation (Figure 7). The expression of migration genes including E-cadherin and Twist-1, determined that E-cadherin was significantly activated in all cells treated, except LC-2. In contrast, the expression of Twist-1 was significantly reduced, except in NCI-H1299. In addition, NCI-H1299 responded to either C. inophyllum extract or quercetin by significantly increasing the expression of Twist-1. Expressions of MMP-2 and MMP-9 as invasion-involved genes declined upon either C. inophyllum extract or quercetin treatments observed in all cancer cell types. However, a statistically insignificant reduction of those genes could be observed in certain cancer cell types including NCI-H1299, LC-1, LC-3, and BC-2. The ROS-responsive genes, NRF2 and HIF-1α responded to the C. inophyllum extract and quercetin in a similar manner. The reductions of NRF2 and HIF-1α were observed in all cell types, except LC-1 and BC-1. The C. inophyllumextract-exposed LC-1 enhanced the expression of NRF2 and HIF-1α. In BC-1, the expression of HIF-1α from the treatments of C. inophyllum extract and quercetin was relatively higher than the controls; however, significant differences were found in the quercetin treatment.
4. Discussion
In this study, we investigated the effects of an ethanolic extract derived from branches of C. inophyllum on cancer cell viability, migration, and invasion. For the first time, we examined the extract’s ability to alleviate intracellular ROS levels, an important factor in cancer progression. Our study was driven by the assumption that antioxidant extracts can effectively reduce free radicals in cells and potentially impede cancer progression.
We optimized the extraction conditions of C. inophyllum extract by using temperatures of 40–50°C and ethanol concentrations of 70–100% to preserve antioxidant properties and maximize bioactive compound yields [31]. The extract exhibited strong antioxidant activity (ranking from 100 to 150 μg/ml) [32], demonstrated by its effective free radical scavenging capabilities (Table 1). GC-MS analysis confirmed the presence of phenolic compounds, flavonoids, and other bioactives, including the newly discovered 5-HMF, contributing to the extract’s antioxidant activity (Table 2). These compounds, characterized by benzene rings with hydroxy or methoxy groups, possess direct and indirect antioxidant properties [33]. Previous studies consistently support the antioxidant capacity of C. inophyllum, including its stem bark and wood [34], highlighting its broad range of bioactivities and antioxidant potential [10]. Thus, C. inophyllum represents a valuable natural resource abundant in antioxidants and bioactive compounds. These compounds hold great promise for diverse therapeutic applications, including the development of anticancer therapies.
The PDCs offer distinct advantages over immortalized cell lines, as they faithfully preserve the cellular assembly, tissue architecture, microenvironment, and cancer niches found in the body. This unique characteristic enables PDCs to exhibit more accurate responses to cytotoxic compounds and enhanced detection of cancer markers, surpassing traditional cell lines [35]. A notable biomarker associated with cancer cell proliferation and metastasis is Ki-67, which is highly expressed in malignant breast and lung cancer cells but is minimally detected in normal proliferating cells [36]. In this study, the PDCs derived from breast or lung cancer demonstrated high Ki-67 expression (>50%) (Figure 3), a significant feature resembling that of cancer cells [37]. This further underscores the resemblance of these PDCs to malignant breast and lung cancer cells, emphasizing their utility as a valuable model for studying cancer biology.
Cytotoxicity and antiproliferation effects of C. inophyllum extracts were evaluated using both PDCs and standard cancer cell lines. A noncancerous cell line was included as a reference to assess the selective index. Quercetin, a natural flavonoid known for its high antioxidant activity, protective effects against oxidative damage, and anticarcinogenic properties, was used as a reference substance [38]. Our findings demonstrate that C. inophyllum extract and quercetin exhibited antiproliferative effects according to the NCI criteria [24] and consistent with previous studies [15–17], while showing no cytotoxicity (Table 4). The selectivity index indicated cancer specificity (>1.0) for most cells, with PDCs showing higher sensitivity to quercetin (Table 5). While the C. inophyllum extract lacked specificity for PDCs, it exhibited time-dependent antiproliferative effects. The presence of bioactive compounds, including 5-HMF and xanthones, likely contributed to the observed anticancer properties, either directly or indirectly [11, 12, 39]. Importantly, the extract demonstrated selectivity for cancer cells, making it a promising candidate for further anticancer drug development.
The antioxidant properties and cancer cell specificity of the C. inophyllum extract were found to be associated with its potential for inhibiting migration and invasion (Figures 4 and 5), which correlated with a reduction in intracellular ROS levels (Figure 6). This was further supported by the upregulation of E-cadherin and downregulation of MMP-9, MMP-2, Twist-1, NRF2, and HIF-1α (Figure 7). The extract and quercetin, known for their antioxidant capabilities, likely alleviated intracellular ROS, leading to the downregulation of NRF2 and HIF-1α. Consequently, the expressions of MMP-2 and MMP-9 were partially restricted, inhibiting epithelial-mesenchymal transition (EMT) [40]. Previous studies have shown that reducing intracellular ROS can disrupt metastasis in various types of cancer by decreasing MMP-2 and MMP-9 expression [41, 42]. Similar effects have been observed with other antioxidants such as silibinin and quercetin derivatives [43, 44]. In addition, the downregulation of NRF2 and HIF-1α, which are associated with cancer cell growth and propagation, has been reported in response to antioxidants [45]. The antioxidant phytochemicals in C. inophyllum extract, including 5-HMF, 2-methoxy-4-vinylphenol, cinnamic derivatives, xanthones, and isoquinolines, likely contribute to the anticancer effects by directly reducing intracellular ROS and inhibiting cell migration and invasion [11, 46].
However, our findings showed differential expression patterns of migration and invasion-related genes in LC-3 and NCI-H1299 cell lines treated with C. inophyllum extract and quercetin. Both treatments resulted in the downregulation of E-cadherin and Twist-1 (Figure 7), suggesting their potential role in inhibiting metastasis. Notably, in highly metastatic lung cancer cells, the association between EMT and MMPs with metastasis appears to be mediated through integrin- and protease-independent mechanisms [47, 48]. Furthermore, 70% of cellular deformation under hypoxia was dependent on Twist-1 and MMPs but not EMT process for their migration [49].
In addition, the exposure to C. inophyllum extract and quercetin led to the reduction of NRF2 and HIF-1α in most cells, with BC-1 and LC-1 cells showing distinct responses (Figure 7). In BC-1, high expression of HIF-1α led to increased ROS levels, a common characteristic of cancer-activated HIF-1α without upstream NRF2 interference. On the other hand, LC-1 cells exhibited increases in both NRF2 and HIF-1α expressions. NRF2 upregulation in response to rising free radicals and ROS serves to maintain redox homeostasis and rescue cells from death, while HIF-1α induction is associated with cancer cell survival mechanisms under fluctuating intracellular ROS levels [50]. Hence, the observed inhibition of migration and invasion in BC-1 and LC-1 cells may not solely be attributed to intracellular ROS levels but likely involves other mechanisms or signaling molecules [51, 52].
The involvement of ROS in various cellular signaling transduction processes, including cancer cell growth, EMT, and metastasis, highlights its significance in cancer biology. However, it is important to acknowledge that cellular responses to ROS are highly diverse and depend on specific cell types. Further purification and investigation of phytochemicals, along with comprehensive cellular biology studies, are needed to unravel the intricate mechanisms underlying cancer cell migration, invasion, and ROS levels. These endeavors hold the potential to provide crucial insights into the complex interplay between ROS and cancer, thereby paving the way for the development of innovative therapeutic strategies targeting ROS-mediated processes in cancer.
5. Conclusions
The ethanolic extract of C. inophyllum demonstrated selective cytotoxicity, antiproliferation, and migration/invasion inhibition which was related to intracellular ROS reduction. The potent anticancer effects might be due to the availability of total phenolic content and total flavonoid content and their strong antioxidant properties. Notably, the prominent phytochemical component responsible for these antioxidant effects is 5-HMF. When tested on both PDCs and standard commercial cell lines of breast and lung cancers, the C. inophyllum extract exhibited specific antiproliferative effects that selectively targeted cancer cells. The extract’s antioxidant properties efficiently attenuated intracellular ROS levels, consequently impeding the migration and invasion processes. This observation was further substantiated by gene expression analysis, revealing a significant increase in E-cadherin expression alongside notable decreases in Twist-1, MMP-2, MMP-9, NRF2, and HIF-1α. Therefore, the findings of this study suggest that the C. inophyllum extract could have the potential to be an alternative therapeutic agent for cancer treatment. Nevertheless, further research and development are still required to fully understand the mechanism of cancer therapy.
Data Availability
The generated or analyzed data used to support the findings of this study are included within the article.
Ethical Approval
The study and all processes were conducted in accordance with the Declaration of Helsinki, and the exemption was approved by the Institutional Research Ethics Committee of the Faculty of Medicine, Chiang Mai University, for studies involving humans (EXEMPTION 8600/2021).
Conflicts of Interest
The authors declare that there are no conflicts of interest.
Authors’ Contributions
Jetsada Ruangsuriya was involved in conceptualization, data curation, writing the original draft, reviewing and editing, applying for ethical approval, and acquiring funding and supervision. Jirapast Sichaem contributed to the review and editing of the manuscript and conducted analysis in the chemical part. Apichat Tantraworasin, Somcharoen Saeteng, and Phanchaporn Wongmaneerung were responsible for cancer tissue collection. Angkhana Inta was responsible for plant identification. Neal M. Davies contributed to formal analysis, data curation, writing the original draft, and reviewing and editing. Kewalin Inthanon was involved in conceptualization, methodology, software development, validation, formal analysis, investigation, resource acquisition, data curation, writing the original draft, reviewing and editing, visualization, supervision, funding acquisition, and project administration. All authors reviewed and approved the final manuscript.
Acknowledgments
The authors gratefully acknowledge the research funds from Thailand Science Research and Innovation Fundamental Fund (nos. TUFF06/2564 and TUFF02/2565) and Thammasat University Research Fund (no. TUFT-FF 2-2565) to Kewalin Inthanon, and Bualuang ASEAN Chair Professorship to Neal M. Davies. Also, this work was also partially supported by Chiang Mai University, Thailand, to Jetsada Ruangsuriya.