Table 1: Sequence of primers used for detection of antibiotics resistance genes.

PrimersSequence (5 to 3)Target geneReference

pse-FACC GTA TTG AGC CTG ATT TAblaP1 class A 𝛽 -lactamase [22]
pse-RATT GAA GCC TGT GTT TGA GC

Class 1 intg FGGC ATC CAA GCA GCA AGClass 1 integron [23]
Class 1 intg RGGC ATC CAA GCA GCA AG

Class 2 int FCGG GAT CCC CGG CAT GCA CGA TTT GTAClass 2 integron [23]
Class 2 int RGAT GCC ATC GCA AGT ACG AG

𝑏 𝑙 𝑎 𝑇 𝐸 𝑀 FAGGAAGAGTATGATTCAACA 𝑏 𝑙 𝑎 𝑇 𝐸 𝑀 [24]
𝑏 𝑙 𝑎 𝑇 𝐸 𝑀 RCTCGTCGTTTGGTATGGC

Tet(C)-1GGT TGA AGG CTC TCA AGG GCTetC [18]
Tet(C)-2GGT TGA AGG CTC TCA AGG GC