Table 1: Primer pairs for H5N1 (SZ 406H).

Target genePrimer nameSequence (5′-3′)

HASZHA-F1/R1CCATTCCACAACATACACCCTC/TTCCCTGCCATCCTCCCT
SZHA-F2/R2ACAAGGTCCGACTACAGC/TTCCGTTTCTTACACTTTCC
SZHA-F3/R3AGAACAATACATACCCAACA/CACTTTGCCCGTTTACTT

NASZNA-F1/R1CAAAGACAGAAGCCCTC/CTCAGTATGTTGTTCCTCCA
SZNA-F2/R2ACAGGGAATCAACACCAA/TACAGCCCATCCTCTAAT
SZNA-F3/R3AAGACAGAAGCCCTCACAG/TTTCAATACAGCCACAGCC

NPSZNP-F1/R1TCAGCGTTCAGCCCACTT/TCGGGTTCGTTGCCTTTT
SZNP-F2/R2CAGCCCACTTTCTCGGTAC/TCGGGTTCGTTGCCTTTT
SZNP-F3/R3GCCAGGTCTTTAGTCTCAT/CTTATAGCCCAATATCTACTTC

NSSZNS-F1/R1AATGCCGACTTCACGCTAC/TCCCACGATTGCTCCTTC
SZNS-F2/R2ATGCCCAAGCAGAAAGTG/TCCGATGAGGACGCCAAT
SZNS-F3/R3AAGAAGGAGCAATCGTGG/CGTTTCTGATTTGGAGGG

MSZM-F1/R1ATTTGTATTCACGCTCACC/TAGTCACCGTTCCCATCC
SZM-F2/R2TTTTGTCCAGAATGCCCTAA/CACCGTTCCCATCCTGTT
SZM-F3/R3TACAACAGGATGGGAACG/AGTGGGTTGGTGATGGTT

PASZPA-F1/R1GGAGTGACACGGAGGGAA/TCTCGGATTGACGAAAGG
SZPA-F2/R2TGGGATTCCTTTCGTCAA/CTGGAGAAGTTCGGTGGG
SZPA-F3/R3TCTATGGGATTCCTTTCG/TCTGGCGTTCACTTCTTT

PB1SZPB1-F1/R1CTTGAAGAATCCCACCCA/AAATCTATCAGCCGTCCC
SZPB1-F2/R2ACATACCGATGCCACAGA/TCAATTCCCATTTCAAGC
SZPB1-F3/R3GCGAGGAGTATCTGTGAG/ATCATTGCCAGAAACATC

PB2SZPB2-F1/R1CTGGGTCGGACAGGGTGAT/AACTCGGCGGCGTATTTT
SZPB2-F2/R2AAACTGGGAGACCGTGAA/GCTCTGCTTAGGTGGTGC
SZPB2-F3/R3AAACTGGGAGACCGTGAA/CTGCTCTGCTTAGGTGGT