Table 2: Primer pairs recommended by WHO for H5N1.

Target genePrimer nameSequence (5′-3′)

HAH5-1/H5-3GCCATTCCACAACATACACCC/CTCCCCTGCTCATTGCTATG
MM30F/M264RTTCTAACCGAGGTCGAAACG/ACAAAGCGTCTACGCTGCAG
N1N1-1/N1-2TTGCTTGGTCGGCAAGTGC/CCAGTCCACCCATTTGGATCC