Table 1: Primers used for PCR.

PCR productForward primer (5′-3′)Reverse primer (5′-3′)Product size (bp)

Elucidation of chick RhoA gene structure

Chick RhoA Intron1GCCGGAATTCATGGCAGCCATTCGAAA1CTATCAGGACTATCGATTG282 bp4
Chick RhoA Intron2GTGGAGTTGGCTTTGTGGGATACGCTTCATTTTGGCCAGCTCT251 bp4
Chick RhoA Intron3AGTGGACCCCGGAAGTGATAAGAGAAGGCACCCGGAC287 bp4

Amplification of putative mouse RhoA promoter

PromoterLongCCCGCGGATCCGTGGCGGGCAAAGCTTGCAG2CCCGCGGATCCGTCCGGCCTCTTCGCGCT637
PromoterShortCCCGCGGATCCAGCAATCGTGGCTGAACTGAG2CCCGCGGATCCGTCCGGCCTCTTCGCGCT264

Generation of dominant mutant of mouse RhoA

mRhoA
N19
CGCCGCTCGAGATGGCTGCCATCAGGAAGAAACTGGTGATTGTT
GGTGATGGAGCTTGTGGTAAGAATTGCTTGCTCATA3
ACGCGTCGACTCACAAGATGAGGCACCC582

Primers used for real-time PCR

GAPDHTCCTACCCCCAATGTGTCCGTCGCCCAAGATGCCCTTCAGTG121
RhoA ORFATTGATGTGTTTTTCCATTGCTCCCGTCTCGTGTGCTCGTCATT151
RhoA 3′UTRGCTACCAGTATTTAGAAGCCAACCACGCTGTTAGAGCAGTGTCAGAAGGAC88
SRFTGCCTCAACTCGCCAGACTCTCTTCAGTGTGTCCTTGGTTTCCC140
Cardiac -actinGCCAACCGTGAGAAGATGACCCGCCAGAATCCAGAACAATGC130
GATA 4ATGCCGAGGGTGAGCCTGTATGCTTCCGTTTTCTGGTTTGAATCC110

Incorporated EcoR1 and BamH1 sites are underlined.
ATG translation start codon and introduced N19 mutation are shown in bold.
Expected size in absence of intron.