Table 1: Sequences of sense and antisense primers used for amplification in real-time PCR.

GeneAccession numberPrimer sequence (5′→ 3′)Temp. °CAmplicon size (bp)

AGG U65989_2Rw: ACTGCTCCAGGCGTGTGATG
Fw: GACCATGTCGTGCAGGTGAC
58405
BAX NM_001003011Rw: TGCTGGCAAAGTAGAAGAGGGCAA
Fw: TTCCGAGTGGCAGCTGAGATGTTT
6079
BCL-2 NM_001002949Rw: GTGCTTTGCATTCTTGGATGAGGG
Fw: CATGCCAAGAGGGAAACACCAGAA
6276
CAS-3 NM_001003042Rw: TTCTGACAGGCCATGTCATCCTCA
Fw: TTCATTATTCAGGCCTGCCGAGG
6283
CAS-9 NM_001031633Rw: TTGTTGATGATGAGGCAGTAGCCG
Fw: TCAGTGACGTCTGTGTTCAGGAGA
6197
COL2A1 AF023169Rw: TGCTTTCCAGTTGGGCCAGC
Fw: GAGCTCCTGGTGCATCTGGA
58233
MMP-3 AY183143_1Rw: CAGAGCTTTCTCAATGGCAG
Fw: CTCACCCAGCAATACCTAGA
55297
GAPDH DQ403060Rw: CGAAGTGGTCATGGATGACT
Fw: AGTATGATTCTACCCACGGC
55362
HAS-1 XM_849398Rw: GCATAGAAGAGCCGCAACAC
Fw: CAGACACGCTGGTCCAAATC
55149
HAS-2 XM_539153Rw: GACTCATCCGTCTCACCAG
Fw: GGTCATAGATGGGAACTCG
51135
TIMP-1 AF077817_1Rw: TGTCACTCTGCAGTTTGCAG
Fw: GATGTTCAAGGGTTTCAGCG
55294