Research Article
Identification and Prevalence of Brucella Species Circulating among Cattle Slaughtered in the Douala and Buea Municipalities of Cameroon
Table 1
Details of oligonucleotide primers used in this study.
| Gene target | Primer sequence (5′-3′) | Amplicon size (bp) | Purpose of PCR | Reference |
| Bcsp31 | B4-F: tggctcggttgccaatatcaa B5-R: cgcgcttgcctttcaggtctg | 223 | Genus specific | [25] | IS711 | F: tgccgatcacttaagggccttcat | | Species specific | [26–28] | B. abortus | R: gacgaacggaatttttccaatccc | 498 | | | B. melitensis | R: aaatcgcgtccttgctggtctga | 731 | | | B. ovis | R: cgggttctggcaccatcgtcg | 976 | | | B. suis | R: gcgcggttttctgaaggttcagg | 285 | | | RB51/2308 | R: ccccggaagatatgcttcgatcc | 364 | Vaccine strain identification | [27] |
|
|
Same forward primer used to amplify all Brucella spp. [ 27]. |