Identification and Prevalence of Brucella Species Circulating among Cattle Slaughtered in the Douala and Buea Municipalities of Cameroon

Table 1

Details of oligonucleotide primers used in this study.

Gene target	Primer sequence (5′-3′)	Amplicon size (bp)	Purpose of PCR	Reference
Bcsp31	B4-F: tggctcggttgccaatatcaa; B5-R: cgcgcttgcctttcaggtctg	223	Genus specific	[25]
IS711	F: tgc​cga​tca​ctt​aag​ggc​ctt​cat		Species specific	[26–28]
B. abortus	R: gac​gaa​cgg​aat​ttt​tcc​aat​ccc	498
B. melitensis	R: aaa​tcg​cgt​cct​tgc​tgg​tct​ga	731
B. ovis	R: cgg​gtt​ctg​gca​cca​tcg​tcg	976
B. suis	R: gcg​cgg​ttt​tct​gaa​ggt​tca​gg	285
RB51/2308	R: ccc​cgg​aag​ata​tgc​ttc​gat​cc	364	Vaccine strain identification	[27]

Same forward primer used to amplify all Brucella spp. [27].