Analytical Cellular Pathology / 2015 / Article / Tab 1

Research Article

Genetic Polymorphism and Expression of CXCR4 in Breast Cancer

Table 1

Quantitative RT-PCR conditions and primers sequences.

GeneGenBank accessionPrimerSequenceMelting
number(°C)

CXCR4 AF025375Forward5′ TGTTGGCTGAAAAGGTGGTC 3′80.5
Reverse5′ AAAGATGAAGTCGGGAATAGTC 3′

GAPDHNM_002046Forward5′ GAAGGTGAAGGTCGGA 3′80.5
Reverse5′ GGGTCATTGATGGCAAC 3′