tRNA-Derived Fragments Target the Ribosome and Function as Regulatory Non-Coding RNA in Haloferax volcanii

Table 1

Overview on tRF sequence reads in the H. volcanii cDNA library.

			tRNA-derived fragment
	tRNA	tRNA #	Begin	End	Sequence (5′–3′)	Length	Reads	Reads/million
Class I	ValGAC	19	2,328,216	2,328,241	GGGUUGGUGGUCUAGUCUGGUUAUGA	26 nt	1,149,000	59,548
	ValGAC	20	2,328,336	2,328,361
	CysGCA	13	1,603,383	1,603,402	GCCAAGGUGGCAGAGUUCGG	20 nt	95,214	4,935
	SerGCT	29	2,620,371	2,620,352	GUUGCGGUAGCCAAGCCUGG	20 nt	44,220	2,292
	LeuCAG	30	2,617,916	2,617,897	GCAGGGAUAGCCAAGUCUGG	20 nt	42,006	2,177
	ArgGCG	43	452,423	452,401	GUCCUGAUAGGGUAGUGGACUAU	23 nt	5,144	267
	AlaGGC	10	1,048,559	1,048,581	GGGCUCGUAGAUCAGGGGUAGAU	23 nt	4,332	225
	LeuGAG	31	2,564,858	2,564,839	GCGUGGGUAGCCAAGCCAGG	20 nt	3,606	187
	ValCAC	33	2,264,075	2,264,050	GGGUUGGUGGUCUAGCCAGGUUAUGA	26 nt	3,576	185
	GlyCCC	35	1,733,386	1,733,366	GCGCCGAUGGUCCAGUGGUAG	21 nt	91	5
Class II	AspGTC	48	311,827	311,755	GCCCGGGUGGUGUAGUGGCCCAUCAUACGA	30 nt	2,094	109
	AspGTC	49	311,725	311,696		30 nt	1,962	102
Class III	LeuCAA	26	2,693,522	2,693,553	AUCCGCUCCCGUAGGGGUCCGUGGGUUCAAAU	32 nt	1,425	74
Class IV	SerGGA	47	408,423	408,380	GCCAGGAUGGCCGAGCGGUAAGGCGCACGCCUGGAAAGCGUGUU	44 nt	291	15

The tRNA genes for which tRFs have been detected are shown. Columns “begin” and “end” list the position of the respective tRF on the H. volcanii chromosome. Sequence, length, and read numbers for each tRF are depicted. The presence of all tRFs could be verified by northern blot analyses (Figure 2 and data not shown), with the exception of ValCAC, GlyCCC, and SerGGA.