Archaea / 2015 / Article / Tab 2

Research Article

Isolation and Molecular Identification of Auxotrophic Mutants to Develop a Genetic Manipulation System for the Haloarchaeon Natrinema sp. J7-2

Table 2

Primers used in this work.

Primer nameSequence (5′-3′)Restriction site

KpnI-1752TAAGGTACCTCGCTGCGATCTTGCAGGGACTKpnI
1752-MfeITAACAATTGCGGCGGTCGCGGGCCACTAAAMfeI
HindIII-1752TTAAAGCTTATGACTCACGAAATCGCCGTCATTHindIII
HindIII-4049TTAAAGCTTATGAGCGCACTCGAAAHindIII
4049-MfeITATCAATTGCCGGTTACGCCACCCCGCGMfeI
MfeI-amyH AATCAATTGATCATATATGCCAACTATTTAMfeI
amyH-PstIAAACTGCAGTAGTGGAAAGCGAGCCAGCPstI
leuA-FATGGCACGTTATCCGCCATCT/
leuA-RTCAGTCGTCGGCCGGCGT/
leuC-FATGAGCGCGGAAACGCTG/
leuC-RTCATACCGAGGTCACCTCCT/
leuD-FATGACGGACGAGGTCGAGATT/
leuD-RTACTCCGCTTCGGGAATCGC/
leuB-FGTGAGTATGACTCACGAAAT/
leuB-RTTACAGTCGGTCGATGAT/
dapA-FGCGACCCAAGAGACCACA/
dapA-RTCATCGCTCATCCTCCG/
dapF-FATGAATATCCCATTTCAGAAGT/
dapF-RTCACGGCTCGGCCGGGGATT/
lysA-FATGAACGAAACCCAAACGTT/
lysA-RTATCGGTCGTATTCGTTGTC/
dapD-FATGAGCGCACTCGAAACCGA/
dapD-RTTACTCCCGCAGCGCGTCCT/
dapB-FATGACGACGCGAATCGGCGTCAC/
dapB-RTCATTCGCTGATCACGTCTGCGAA/
argF-FATGACGACCGATTCCGATCC/
argF-RTCACTCGAGCACCCAACTCA/
argE-FATGAGTGCAACCATGGACGACA/
argE-RTCATTCGTCGTCCTCGCGAA/
argD-FATGAGCGACCTCGATTTCGT/
argD-RTCATGCGTTGGAGTCGGT/
argB-FGGGCACCCTAACATGACGAC/
argB-RTCATTGGGCCACCTCC/
argC-FATGGCGGTCGGGACCGAG/
argC-RTTAGGGTGCCCCCACGGG/
argXW-FATGACCGAATGCGTCGAGTG/
argXW-RTCAGGCGGTCACCTC/
argH-FATGACCGAGGAGAGCGCTCAC/
argH-RTCAGACATAGCCGTTCACCT/
argG-FGATATGACCCGCGTGGCACT/
argG-RTTACTGGTCGTCTCCCGTCCC/

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.