BioMed Research International

BioMed Research International / 2008 / Article
Special Issue

Frontiers in the Convergence of Bioscience and Information Technology

View this Special Issue

Research Article | Open Access

Volume 2008 |Article ID 735101 |

Mee-Jung Han, Jeong Wook Lee, Sang Yup Lee, Jong Shin Yoo, "Proteome-Level Responses of Escherichia coli to Long-Chain Fatty Acids and Use of Fatty Acid Inducible Promoter in Protein Production", BioMed Research International, vol. 2008, Article ID 735101, 12 pages, 2008.

Proteome-Level Responses of Escherichia coli to Long-Chain Fatty Acids and Use of Fatty Acid Inducible Promoter in Protein Production

Academic Editor: Daniel Howard
Received31 Aug 2007
Accepted18 Nov 2007
Published17 Dec 2007


In Escherichia coli, a long-chain acyl-CoA is a regulatory signal that modulates gene expression through its binding to a transcription factor FadR. In this study, comparative proteomic analysis of E. coli in the presence of glucose and oleic acid was performed to understand cell physiology in response to oleic acid. Among total of 52 proteins showing altered expression levels with oleic acid presence, 9 proteins including AldA, Cdd, FadA, FadB, FadL, MalE, RbsB, Udp, and YccU were newly synthesized. Among the genes that were induced by oleic acid, the promoter of the aldA gene was used for the production of a green fluorescent protein (GFP). Analysis of fluorescence intensities and confocal microscopic images revealed that soluble GFP was highly expressed under the control of the aldA promoter. These results suggest that proteomics is playing an important role not only in biological research but also in various biotechnological applications.

1. Introduction

Exogenous fatty acids and their derivatives influence a wide variety of cellular processes including fatty acids and phospholipids synthesis, organelle inheritance, vesicle fusion, protein export and modification, enzyme activation or deactivation, cell signaling, membrane permeability, bacterial pathogenesis, and transcriptional control [1, 2]. The process governing the transport of fatty acids from environmental conditions across the membrane is distinct from the transport of hydrophilic substrates such as sugars and amino acids. In a number of cell types, the process of fatty acid transport is inducible and commensurate with the expression of specific sets of proteins [2]. In wild-type Escherichia coli, growth on fatty acids requires specific transport system (FadL), acyl-CoA dehydrogenase (FadD), enzymes of the β-oxidation cycle (FadA, FadB, FadE, FadF, FadG, and FadH), and glyoxylate shunt (AceA, AceB, and AceK), and these genes are negatively regulated by a transcriptional factor, FadR. Supply of long-chain fatty acids that contain 12 or more carbons results in the derepression of the genes negatively controlled by FadR but leads to the decreased expression of the genes (e.g., fabA and fabB) activated by FadR, indicating that long-chain acyl-CoA esters are the effector molecules that regulate fatty acids metabolism and thereby mediate inductions [3]. Therefore, E. coli cells can grow on minimal medium containing long-chain fatty acids but it cannot grow on short- and medium-chain fatty acids due to no induction of the enzymes associated with fatty acids metabolism. So far, genes involved in fatty acids metabolism (i.e., fad regulon) of E. coli have been reported at the transcriptional level by biochemical and genetic analyses [36]. Therefore, in this study, we looked at the effects of long-chain fatty acids at the translational level of E. coli.

Proteomics has changed the way to study cellular physiology. Previously, one or more proteins were chosen as models for understanding local physiological phenomena. Nowadays, proteomic studies allow researchers to identify large members of stimulons, a set of proteins whose amount or synthesis rate changes in response to a certain stimulus, and to obtain information that indicates which specific proteins should be studied further. Comparative proteome profiling under various environmental conditions also reveal new regulatory circuits and the relative abundances of protein sets at the system-wide level. Such analyses of every protein induced or repressed by the stimulus may provide the necessary information to understand a response in the cell. Furthermore, proteome profiles can prove invaluable when used in conjunction with various molecular biological tools including recombinant DNA technology [7]. For example, conditional promoters activated by the specific stimulus, such as stationary phase, pH, temperature, and nutrient limitation have been used for efficient production of heterologous proteins in bacteria [8].

In this study, proteomic studies that compared global translational differences between E. coli W3110 cells in the presence of glucose and oleic acid (C18) were conducted. The present study has three goals: (i) to identify the stimulon of the oleic acid; (ii) to select target proteins from the stimulon to utilize them as the oleic acid-inducible promoter; and (iii) further to apply it for the production of recombinant proteins or other biotechnological systems.

2. Materials and Methods

2.1. Bacterial Strains and Plasmids

The bacterial strains and plasmids used in this study are shown in Table 1. E. coli XL1-Blue was used as a strain forcloning and maintenance of plasmids. E. coli W3110 was used as a host strain for proteomic studies and the production of a recombinant protein. PCR primers used in this study are listed in Table 2. Primers for the amplification of the promoter regions of aldA and udp genes were designed based on the genome sequence of E. coli K-12 W3110 (AC_000091). The promoter region of aldA gene was amplified by PCR using primers 1 and 2, and was cloned into the EcoRV and EcoRI sites of pTac99A to make pAD99A (Table 1). In fact, pTac99A is a derivative of pTrc99A (Pharmacia Biotech., Uppsala, Sweden), which was constructed by replacing the trc promoter of pTrc99A with the tac promoter from pKK223-3 (Pharmacia Biotech) digested by PvuII and EcoRI [9]. Also, the promoter region of udp gene was amplified by PCR using primers 3 and 4, and was cloned into the EcoRV and EcoRI sites of the high-copy-number plasmid pTac99A to make pUP99A (Table 1). Both promoters were constructed with the ribosome binding sites consisting of the AGGA sequence having an optimal distance length of 8 bases from a start codon [10].

Strain or plasmidRelevant characteristicsReference or source

E. coli strains
XL1-BluerecA1, endA1, gyrA96, thi, hsdR17, suppE44, relA1, l-, lac-, F’[proAB laclq lacZ M15, Tn10 (tet)r]Stratagenea
W3110F-mcrA mcrB IN(rrnD-rrnE)1 -KCTCb

pTac99ApTrc99A derivative; tac promoter, cloning vehicle; AprPark and Lee [9]
pAD99ApTac99A derivative; aldehyde dehydrogenase (aldA) promoter; AprThis study
pUP99ApTac99A derivative; uridine phosphorylase (udp) promoter; AprThis study
pGFPuvApr, lac promoter, gfpClontechc
pAD99GFPpAD99A derivative; gfpThis study
pTac99GFPpTac99A derivative; gfpThis study
pUP99GFPpUP99A derivative; gfpThis study

aStratagene Cloning System (La Jolla, Calif, USA).
bKorean Collection for Type Cultures, (Daejeon, Korea).
cBD Biosciences Clontech (Palo Alto, Calif, USA).

PrimerPrimer sequenceaGene to be amplifiedTemplate

Primer 1aaaaccgttgatatctttgcaaacgggcatgactcctgacttttaldA promoterE. coli W3110 chromosome
Primer 2aaaaccgttgaattcctcctgtgatttatatgtttgttttc
Primer 3aaaaccgttgatatctgcagaatgaagggtgatttatgtgatttgudp promoterE. coli W3110 chromosome
Primer 4aaaaccgttgaattcctcctctgtgaatcggtttagtcaga
Primer 5ggaattcatgagtaaaggagaagaacttt GFP pGFPuv
Primer 6cccaagcttttatttgatgagctcatcc

aRestriction enzyme sites are shown in bold.

PCR was performed in the PCR Thermal Cycler MP (Takara Shuzo Co., LTD., Shiga, Japan) using the Expand High Fidelity PCR System (Roche Molecular Biochemicals, Mannheim, Germany). DNA sequencing was carried out using the Bigdye terminator cycle sequencing kit (Perkin-Elmer Co., Boston, Mass, USA), Taq polymerase and the ABI Prism 377 DNA sequencer (Perkin-Elmer Co., Mass, USA). All DNA manipulations were carried out according to standard procedures [11].

2.2. Cell Growth Conditions and Analytical Procedure

Cells were cultivated at 37°C and 250 rpm in 100 mL of Luria-Bertani (LB) medium (10 g/L of tryptone, 5 g/L of yeast extract, and 5 g/L of NaCl), or R/2 medium plus 10 g/L glucose or 5 g/L oleic acid (Daejung Chemicals & Metals Co., Gyeonggi-do, Korea) as a carbon source. The R/2 medium (pH 6.8) contains per liter: 2 g of (NH4)2HPO4, 6.75 g of KH2PO4, 0.85 g of citric acid, 0.7 g of MgSO4·7H2O, and 5 mL of a trace metal solution. The trace metal solution contains per liter of 5 M HCl : 10 g of FeSO4·7H2O, 2.25 g of ZnSO4·7H2O, 1 g of CuSO4·5H2O, 0.5 g of MnSO4·5H2O, 0.23 g of Na2B4O7·10H2O, 2 g of CaCl2·2H2O, and 0.1 g of (NH4)6MO7O24. For the cultivation of recombinant E. coli strains, ampicillin (Ap, 50  g/mL) was added. Cell growth was monitored by measuring the absorbance at 600 nm (OD600; DU Series 600 Spectrophotometer, Beckman, Fullerton, Calif, USA). At an OD600 of 0.7 or 1.2, isopropyl-β-D-thiogalactopyranoside (IPTG, Sigma Chemical Co., St. Louis, Mo, USA) was added at a final concentration of 1 mM. For induction by oleic acid, the defined medium supplemented with 10 g/L glucose was changed into the medium plus 5 g/L oleic acid after cells were collected by centrifugation at the same OD600 of 0.7 or 1.2. Then, cells were further cultivated for 5, 10, and 20 hours, and harvested by centrifugation at 3,500 g for 5 minutes at 4°C. Protein samples were analyzed by electrophoresis on 12% (w/v) sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli [12]. The gels were stained with Coomassie brilliant blue R250 (Bio-Rad, Hercules, Calif, USA), and the protein bands were quantified by a GS-710 Calibrated Imaging Densitometer (Bio-Rad).

2.3. Two-Dimensional Gel Electrophoresis (2DE)

Proteome analysis was performed by 2DE using the IPGphor IEF system (GE Healthcare, Chalfont St. Giles, UK) and Protean II xi Cell (Bio-Rad) as described previously [13]. In brief, E. coli W3110 cells grown in the presence of glucose and oleic acid were harvested at the exponential and stationary phases, respectively, by centrifugation for 5 minutes at 3,500 g and 4°C, and washed four times with low-salt washing buffer. The pellet was then resuspended in 600  L of a buffer containing 10 mM Tris-HCl (pH 8.0), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.1% (w/v) SDS, and 1% (v/v) cocktail protease inhibitor (Complete Mini EDTA-free; Roche Diagnostics GmbH, Germany). One  L of this sample was mixed with 60  L of a solution consisting of 8 M urea, 4% (w/v) CHAPS, 40 mM Tris, 65 mM DTT, and a trace of bromophenol blue. Proteins (200  g) quantified by Bradford assay [14] were resuspended in 350  L of IEF denaturation buffer composed of 8 M urea, 2% (w/v) CHAPS, 20 mM DTT, and 0.8% (v/v) IPG buffer (pH 3–10 NL; GE Healthcare). The samples were carefully loaded on the IPG strips (18 cm, pH 3–10 NL; GE Healthcare). The loaded IPG strips were rehydrated for 12 hours and focused at 20°C for 15 minutes at 250 V, followed by 8,000 V until a total of 60,000 V·h was reached. The strips were equilibrated in two equilibration buffers as described previously [15] and then placed on 12% (w/v) SDS-PAGE gels prepared by the standard protocol [12]. Protein spots were visualized using a silver staining kit (GE Healthcare), and the stained gels were scanned by a GS-710 Calibrated Imaging Densitometer (Bio-Rad). ImageMaster 2D Platinum Software (version 5.0; GE Healthcare) was used to identify spots, to match gels, and to quantify spot densities on a volume basis (i.e., integration of spot optical intensity over the spot area).

2.4. Fractionation of Outer Membrane Proteins

Culture broth (3 mL) was centrifuged at 3,500 g for 5 minutes at 4°C, and the pellet was washed with 1 mL of 10 mM Na2HPO4 buffer (pH 7.2), followed by centrifugation at 3,500 g for 5 minutes at 4°C. The cell pellet was resuspended in 0.5 mL of 10 mM Na2HPO4 buffer (pH 7.2). Crude extracts of E. coli cells were prepared by five cycles of sonication (each for 15 seconds at 20% of maximum output; High-intensity ultrasonic liquid processors; Sonics & Material Inc., Newtown, Conn, USA). Partially disrupted cells were first removed by centrifugation of sonicated samples at 12,000 g for 2 minutes at room temperature. Membrane proteins and lipid layers were isolated by centrifugation at 12,000 g for 30 minutes at 4°C, followed by resuspension in 0.5 mL of 0.5% (w/v) sarcosyl in 10 mM Na2HPO4 buffer (pH 7.2). After incubation at 37°C for 30 minutes, the insoluble pellet containing membrane proteins was obtained by centrifugation at 12,000 g for 30 minutes at 4°C. Membrane proteins were obtained by washing the insoluble pellet with 10 mM Na2HPO4 buffer (pH 7.2), followed by resuspending in 50  L of Tris-EDTA buffer (pH 8.0).

2.5. Protein Identification by LC-MS/MS Analysis

Samples for the MS/MS analysis were prepared as described previously [16]. Briefly, protein spots were excised and destained by incubating in 30 mM potassium ferricyanide and 65 mM sodium thiosulfate for 10 minutes. Gel pieces were washed in Milli-Q water until they became colorless and transparent, and then vacuum-dried. These pieces were proteolysed with 0.02  g/ L of modified trypsin (Promega, Madison, Wis, USA) in 40 mM ammonium bicarbonate for overnight at 37°C. Tryptic peptides (10  L aliquots) were analyzed by a nano-LC/MS system consisting of an Ultimate HPLC system (LC Packings, Amsterdam, Netherlands) and a quadrupole-time-of-flight (Q-TOF) MS (Micromass, Manchester, UK) equipped with a nano-ESI source as described previously [15]. The MASCOT search server (version 1.8; was used for the identification of protein spots by querying sequence of the tryptic peptide fragments. Reference databases used for the identification of target proteins were UniProt Knowledgebase (Swiss-Prot and TrEMBL; and NCBI (

2.6. Fluorescence Microscopy and Intensity of GFP

For fluorescence imaging, cells were harvested by centrifugation for 5 minutes at 3,500 g and 4°C, washed with and resuspended in phosphate-buffered saline (PBS) solution. The samples were mounted on microscopic slide glasses and examined by confocal microscopy (Carl Zeiss, Jena, Germany). Photographs were taken with a Carl Zeiss LSM 410 instrument. Samples were excited by a 364-nm argon laser, and images were filtered by a longpass 505-nm filter. Three-dimensional images were constructed from 5–10 serial images (each 1-Am thick) made by automatic optical sectioning. Fluorescence intensities were measured at 395 nm (excitation) and 509 nm (emission) using the SpectraMax M2 multi-detection system (Molecular Devices, Sunnyvale, Calif, USA), and a 96-well black and clear flat-bottom plate (Coastar, Los Angeles, Calif, USA).

3. Results and Discussion

3.1. Proteome Analysis

To understand physiological changes triggered by the long-chain fatty acid, we analyzed the proteome profiles of E. coli K-12 W3110 grown in the presence of glucose and oleic acid, respectively. The final concentration of cells cultured in oleic acid as a carbon source was 4-fold higher than that of cells grown in glucose, although the former took a longer lag-period for induction of the fad regulon (see Figure 1). Samples of proteome were taken at the exponential and stationary phases in two different media (see Figure 1): when the OD600 of E. coli reached 0.57 and 1.25 in the presence of glucose, named G1 and G2, respectively; and when the OD600 reached 0.56 and 5 in the presence of oleic acid, named O1 and O2, respectively. The proteome profiles of the four samples, G1, G2, O1, and O2, were analyzed by 2D PAGE using a strip of 3–10 pI range and 12% polyacrylamide gel for subsequent comparisons (see Figure 2). The overall profiles of whole cellular proteins were reproducible. From over 2,000 spots on each 2D gel shown in Figure 2, we identified 92 proteins by comparing with our in-house E. coli proteome database or by conducting LC-MS/MS analysis. Functions and fold changes of individual proteins are shown in Table 3.

Spot no.Protein nameMethod for identityAccession no.pI/Mwa (kDa)Protein descriptionFold changeb

1AcnBGel matchP366835.24/75.9Aconitate hydratase 2
2AsnSGel matchP172425.64/92.8Asparaginyl-tRNA synthetase
3AceFGel matchP069595.01/77.5Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex
4DnaKGel matchP044754.81/69.6Chaperone protein DnaK
5PtsIGel matchP088394.78/59.8Phosphoenolpyruvate-protein phosphotransferase 3
6AldAMS/MSP255535.07/52.2Aldehyde dehydrogenase AAppearedAppeared
7MopA (GroEL)Gel matchP061394.85/56.760 kDa chaperonin (GroEL protein)
8TigGel matchP222574.83/51.0Trigger factor (TF)
9HtpGGel matchP104135.06/65.6Chaperone protein HtpG (Heat shock protein HtpG)
10AtpDGel matchP008244.90/47.7ATP synthase beta chain
11Icd (IcdA)Gel matchP082005.02/46.0Isocitrate dehydrogenase
12AceA1MS/MSP053135.19/44.1 5.12/44.1Isocitrate lyase5 7
AceA2MS/MS5.01/33.8Isocitrate lyase fragment6 7
13GlnAGel matchP067115.25/53.8Glutamine synthetase
14IlvCGel matchP057935.26/52.0Ketol-acid reductoisomerase
15GlpKGel matchP088595.30/50.6Glycerol kinase (Glycerokinase)
16EnoGel matchP083245.34/46.5 5.29/46.2Enolase (2-phosphoglycerate dehydratase)
17TufA (EF-Tu)Gel matchP029905.32/44.6Elongation factor Tu (EF-Tu)
18FabD (TfpA)Gel matchP257155.37/44.8Malonyl CoA-acyl carrier protein transacylase
19LeuCGel matchP301275.42/44.4 5.95/51.63-isopropylmalate dehydratase large subunit
20FadBMS/MSP211775.84/79.5Fatty oxidation complex alpha subunitAppearedAppeared
21SdhAGel matchP104445.74/63.7Succinate dehydrogenase flavoprotein subunit
22OppAGel matchP238435.93/56.1Periplasmic oligopeptide-binding protein
23TrpDGel matchP009046.08/55.9Anthranilate synthase component II; Anthranilate
24GuaB (GuaR)Gel matchP069816.01/55.0Inosine- -monophosphate dehydrogenase
25AtpAGel matchP008225.84/53.1ATP synthase alpha chain
26DppAGel matchP238475.69/52.1Periplasmic dipeptide transport protein
27GlyAGel matchP004776.04/45.9 5.94/46.1Serine hydroxymethyltransferase (Serine methylase)
28CarA (PyrA)Gel matchP009075.91/44.0Carbamoyl-phosphate synthase small chain
31FadAMS/MSP211516.31/40.9Fatty oxidation complex beta subunitAppearedAppeared
32FbaGel matchP116045.55/40.6Fructose-bisphosphate aldolase class II
33SerC (PdxF)Gel matchP237215.34/40.2Phosphoserine aminotransferase
34SucCGel matchP074605.30/42.3Succinyl-CoA synthetase beta chain
35LivJMS/MSP029175.28/41.9Leu/Ile/Val-binding protein
36PgkGel matchP116655.07/41.9 5.02/41.7Phosphoglycerate kinase
37MalEMS/MSP029285.08/41.1Maltose-binding periplasmic proteinAppearedAppeared
38LivKGel matchP048165.00/41.4Leucine-specific binding protein
39RfaD (HtrM)Gel matchP179634.85/36.8ADP-L-glycero-D-manno-heptose-6-epimerase
40PotDGel matchP238614.77/35.8Spermidine/putrescine-binding periplasmic protein
41TalBGel matchP301485.01/35.8Transaldolase B
42Tsf (EF-Ts)Gel matchP029975.15/33.6Elongation factor Ts (EF-Ts)
43MdhMS/MSP069945.55/35.5Malate dehydrogenase
44CysKGel matchP110965.81/36.0Cysteine synthase A
45ManX (PtsL)Gel matchP081865.17/26.1PTS system, mannose-specific IIAB component
46UnknownMS/MS2 3
47AroGGel matchP008866.12/39.4Phospho-2-dehydro-3-deoxyheptonate aldolase2
48SbpGel matchP069976.49/49.5Sulfate-binding protein2
49GapAGel matchP069776.58/36.3Glyceraldehyde 3-phosphate dehydrogenase A
50PyrBGel matchP004796.13/35.3Aspartate carbamoyltransferase catalytic chain
51FkpAGel matchP455237.08/33.2FKBP-type peptidyl-prolyl cis-trans isomerase FkpA
52SucDMS/MSP074596.31/29.6Succinyl-CoA synthetase alpha chain
53GapAMS/MSP069776.58/23.0No. 49 fragmentDisappearedDisappeared
54GlnHMS/MSP103446.87/24.9Glutamine-binding periplasmic protein
55SodAGel matchP004486.44/22.9Superoxide dismutase [Mn] (MnSOD)
56RbsBMS/MSP029255.92/29.1D-ribose-binding periplasmic proteinAppearedAppeared
57UdpGel matchP127585.86/27.9Uridine phosphorylase (UDRPase)AppearedAppeared
58YadKGel matchP370165.55/28.4Protein YadK
59TpiA (Tpi)Gel matchP047905.57/26.9Triosephosphate isomerase
60CddMS/MSP136525.08/31.5Cytidine deaminaseAppearedAppeared
61TrpAGel matchP009285.30/28.7Tryptophan synthase alpha chain
62SspA (Ssp)Gel matchP058385.24/26.6Stringent starvation protein A
63HisJGel matchP391825.05/28.6Histidine-binding periplasmic protein
64FliYGel matchP391745.01/26.2 5.11/25.8Cystine-binding periplasmic protein 3
65HdhA (HsdH)Gel matchP255295.17/25.07-alpha-hydroxysteroid dehydrogenase
66Upp (UraP)Gel matchP255325.29/23.8Uracil phosphoribosyltransferase
67GrpEGel matchP093724.68/25.5GrpE protein (HSP-70 cofactor)2
68AccB (FabE)Gel matchP029054.57/22.0Biotin carboxyl carrier protein of acetyl-CoA carboxylase2 2
69YfdXMS/MSP765205.38/23.0Protein yfdXDisappearedDisappeared
70AhpCGel matchP264275.01/21.5Alkyl hydroperoxide reductase C22 protein
71CrrGel matchP088374.57/20.0 4.68/18.9PTS system, glucose-specific IIA component
72DksAGel matchP182744.90/18.7DnaK suppressor protein
73AroKGel matchP241675.30/17.9Shikimate kinase I
74SodBGel matchP091575.53/22.1Superoxide dismutase [Fe]2
75PpiBGel matchP238695.51/17.7Peptidyl-prolyl cis-trans isomerase B
76RplIGel matchP024186.20/19.8 6.17/15.750S ribosomal protein L9
77YbdQGel matchP391776.08/15.5Unknown protein from 2D-page
78RbfAGel matchP091706.00/15.6Ribosome-binding factor A
79RplUGel matchP024226.71/10.350S ribosomal protein L212 3
80HnsGel matchP089365.45/15.6DNA-binding protein H-NS (Histone-like protein HLP-II)
81NdkGel matchP242335.59/15.2Nucleoside diphosphate kinase (NDP kinase)
82AtpCGel matchP008325.48/14.8ATP synthase epsilon chain
83RpsFGel matchP023585.31/15.8 5.15/15.8 5.26/15.830S ribosomal protein S6
84BcpGel matchP234805.02/15.8Bacterioferritin comigratory protein 2
85GreAGel matchP213464.68/15.9Transcription elongation factor GreA2 Disappeared
86GroES (MopB)Gel matchP053805.15/15.610 kDa chaperonin (GroES protein)
87YfiDMS/MSP336335.09/14.3Protein YfiD
88UspAGel matchP282425.14/15.1Universal stress protein A
89YjgFGel matchP393305.29/13.0Protein YjgF
90TrxA (TsnC)Gel matchP002744.67/11.5Thioredoxin 1
91HdeBGel matchP266054.85/11.2Protein HdeB (10K-L protein)3
92YccUMS/MSP758746.72/14.7Protein YccU; Predicted CoA-binding proteinAppearedAppeared

aUnit of the molecular weight (MW) is kDa.
bFold change: 0 ~0.3-fold, 3 ; 0.3 ~0.5-fold, 2 ; 0.5 ~0.6-fold, ; 1.5-fold, ; 2-fold, 2 ; fold change, fold number .

The outer membrane proteins were enriched by fractionation, and separated on 12% SDS-PAGE (see Figure 3). Membrane proteins are typically difficult to be resolved in the IEF denaturation buffer used commonly for 2D gels because of their hydrophobic property. The highly abundant porin, OmpF whose expression level was regulated by osmolarity [17], was observed at the exponential phase of E. coli in the presence of glucose. As expected, the long-chain fatty acid transporter protein, FadL, was newly synthesized in the presence of oleic acid. This result proves that E. coli requires the specific transport system (fadL) on the growth of fatty acids.

3.2. Identification of the Proteins Stimulated by Oleic Acid

To examine the influence of oleic acid on the proteome profile variation, we compared the proteomes obtained from the exponential phase (O1 versus G1) and the stationary phase (O2 versus G2), as shown in Table 3. At the exponential growth phase, the levels of 41 identified proteins were altered in the presence of oleic acid. Among them, 9 proteins including AldA, Cdd, FadA, FadB, FadL, MalE, RbsB, Udp, and YccU were newly synthesized in response to oleic acid, while GapA (the fragment), hypothetical protein YfdX, and two unidentified proteins were not detectable. As expected, the levels of proteins involved in fatty acid degradation (FadA and FadB), long-chain fatty acid transport system (FadL), glyoxylate shunt (AceA). and TCA cycle (Mdh, SdhA, SucC, and SucD) were significantly increased to replenish the dicarboxylic acid intermediates consumed in amino acid biosynthesis. Particularly, isocitrate lyase (AceA) in the aceBAK operon was significantly synthesized by more than five folds in the presence of oleic acid, making it the most abundant protein. Concurrently, there were decreased levels of proteins involved in the biosynthesis of fatty acids (FabD and FabE) and amino acids (AroG, LeuC, and SerC). These results showed that the variation patterns of most proteins identified as a fad regulon were in agreement with their corresponding transcriptional levels previously reported [26].

Furthermore, the growth of E. coli on oleic acid involves a significant contribution of the pyrimidine salvage pathway (Cdd and Udp) and specific binding-protein-dependent transport system (MalE and RbsB) because the levels of these proteins highly increased by oleic acid. The salvage pathway of E. coli functions to reutilize free bases and nucleosides produced intracellularly from nucleotide turnover [18]. Also, the pyrimidine salvage pathway has been reported to recycle the pentose moieties of exogenous nucleosides to use them as carbon and energy sources and the amino groups of cytosine compounds as a nitrogen source. The D-ribose-binding periplasmic protein, RbsB in the rbsACBK operon, mediates the entry of D-ribose across the cell membrane in the form of D-ribose 5-phosphate, which is an intermediate of the pentose phosphate cycle [19]. Therefore, long-chain fatty acids seem to influence the status of the pyrimidine salvage pathway and its associated transport system.

Interestingly, aldehyde dehydrogenase (AldA), which oxidize diverse aldehydes throughout the cellular metabolism, received a special attention in this study because of its possible applications in gene expression system with oleic acid as an inducer. It has been reported that the expression of aldA gene was induced on growth on fucose, rhamnose, arabinose, glutamate, or 2-oxoglutarate during aerobic condition, while that is repressed by glucose [20]. Our observation found in this study demonstrated that oleic acid is another inducer of the aldA gene. Its application as an inducible promoter is demonstrated in the next two sections.

At the stationary phase, the levels of 45 identified proteins were altered in response to oleic acid (Table 3). Sixteen proteins including AceA, AcnB, AldA, AtpA, Cdd, FadA, FadB, FadL, Hns, Icd, MalE, RbsB, SucC, SucD, Udp, and YccU were significantly increased or newly synthesized, while 29 proteins were reduced or disappeared on 2D gels. Although the variations of proteins at the stationary phase were more complex, most proteins with altered levels on 2D gels at this phase showed patterns similar to those at the exponential growth phase.

3.3. Construction of the Expression System with Oleic Acid-Inducible Promoters

Among proteins highly inducible by oleic acid, we selected two target proteins, AldA and Udp according to the following two criteria for their utilization as promoters: (i) they are only induced in the presence of oleic acid to be strictly controlled; (ii) they are strongly and highly expressed for the enhanced bioproducts production. AldA and Udp were synthesized in response to oleic acid with relatively high abundance from the exponential to stationary phases, and were not synthesized in the presence of glucose, suggesting that the native promoters of these proteins could be used as an oleic acid-inducible promoter in E. coli W3110.

For the construction of the expression systems controlled by aldA or udp promoter, the promoter regions of these genes were amplified as described in Section 2. The representative schematic plasmid map under the control of aldA promoter is illustrated in Figure 4. This is a high-copy-number plasmid with replication origin of pBR322 (ATCC 37017).

3.4. Comparison between the Expression Efficiency of Oleic Acid- and IPTG-Inducible Promoters

Various cultivation strategies employing different host strains and expression systems have been employed for the production of recombinant proteins [10, 21]. One of the most popular approaches is the use of different promoters to regulate expression levels [10]. In E. coli, many inducible promoters have been developed, which can be induced by various mechanisms such as temperature upshifting, pH fluctuation, nutrient starvation, and addition of chemical inducers. Among these inducible systems, T7 or lac-based promoters (tac, trc, lac, lacUV5-T7 hybrid, etc.), which can be effectively induced by the addition of IPTG, are the most frequently used ones.

In order to evaluate the effectiveness of oleic acid-inducible promoters discovered in this study, we chose the IPTG-inducible tac promoter as a control. Green fluorescent protein (GFP) from the jellyfish Aequorea Victoria was employed as a model recombinant protein to examine its expression under the control of aldA or udp promoter. For the induction of GFP by oleic acid, the defined medium supplemented with glucose was transferred into oleic acid medium at the OD600 of 0.7 or 1.2. For the control, cells harboring the plasmid containing tac promoter were added with 1 mM IPTG at the same values of OD600 in the defined medium supplemented with glucose. After induction by IPTG or oleic acid, cells were further cultured, harvested at each time, and analyzed by 12% SDS-PAGE (see Figure 5). When GFP is induced at the OD600 of 1.2 in recombinant E. coli W3110 harboring pTac99GFP, pAD99GFP, and pUP99GFP, its contents were approximately 27%, 42%, and 25% of the total proteins at 10 hours, and 28%, 50%, and 25% at 20 hours, respectively. The GFP content induced by aldA promoter was about 2-fold higher than that obtained by IPTG-inducible tac or udp promoter. Under the IPTG-inducible promoter, the expression of GFP was low even in LB medium compared to the oleic acid-inducible aldA promoter (data not shown). Additionally, the final cell concentration of recombinant E. coli W3110 cells in the presence of oleic acid was 4-fold higher than that of recombinant E. coli cultured in glucose as a carbon source. This result was further confirmed by fluorescence intensity measurements and confocal microscopy (see Figure 6). Strong fluorescence was uniformly detected in recombinant E. coli cells under the control of aldA promoter. The fluorescence intensity of GFP obtained from W3110 harboring pAD99GFP was more than 30-fold higher than that obtained from W3110 harboring pTac99GFP, indicating that the aldA promoter efficiently enhances recombinant protein production compared to the tac promoter. Since the aldA promoter was not activated by glucose, GFP was not produced in the presence of glucose in accordance with the proteome profiles. GFP was only produced under the aldA promoter along with the supply of exogenous oleic acid. However, the tac promoter was not tightly controlled, leaking the recombinant protein even without IPTG induction. These results manifest that the aldA promoter is very efficient for the production of recombinant proteins in E. coli as an inducible promoter. The maximum productivity can be achieved when the growth and production phases are separated as conducted in this study. Separation of the two phases is often achieved by delaying induction time until the cell density reaches a suitable value.

Until now, the IPTG-inducible promoters tac or trc have been widely used for basic research. However, the use of IPTG for the large-scale production of human therapeutic proteins is undesirable because of its toxicity and relatively high cost; the high concentration of IPTG can inhibit cell growth and recombinant protein production [22, 23]. Therefore, determination of optimal induction time point as well as the inducer concentration is crucial to increase the overall productivity of recombinant protein. In this regard, there have been significant efforts to overcome such problems by using different inducible or even constitutive expression systems [24]. Thus, the aldA promoter found in this study can be effectively used for the enhanced production of recombinant proteins with the aforementioned problems largely resolved.

In summary, the aldA promoter satisfies requirements for its utilization as a promoter. First, it is tightly controllable with an appropriate inducer, oleic acid in this case. Tight regulation of the promoter is essential for the synthesis of proteins which may be detrimental to the host cell. For example, the toxic rotavirus VP7 protein effectively kills cells, and must be produced under tightly regulated conditions [25]. Second, its expression is strong and long lasting, resulting in the accumulation of the target protein constituting up to 50% of the total cellular proteins. The third important characteristic of aldA promoter is its inducibility in a cost-effective manner by using exogenous oleic acid as an inducer.

4. Conclusion

Proteome analysis of the cells with focus on proteins induced or repressed by the stimulus provides clues to the understanding of cellular responses. This study revealed that 52 proteins showed significantly altered levels in E. coli grown with oleic acid compared to the glucose. Based on the resulting proteome profiles, the promoter of aldA gene was found to be strongly activated by oleic acid and subsequently to be demonstrated useful as an inducible promoter for the enhanced production of desirable targets. Thus, this study demonstrates that E. coli proteome profiles not only provide invaluable information for physiological status of the organism under specific conditions but also propose its biotechnological applications.


We thank Z. W. Lee (Korea Basic Science Institute, Daejeon, Republic of Korea) for his help with the confocal microscopy. This work was supported by the Korean Systems Biology Research Grant (M10309020000-03B5002-00000) of the Ministry of Science and Technology. Further supports by LG Chem Chair Professorship, IBM SUR program, Microsoft, and by the KOSEF through the Center for Ultramicrochemical Process Systems are appreciated.


  1. P. N. Black and C. C. DiRusso, “Molecular and biochemical analyses of fatty acid transport, metabolism, and gene regulation in Escherichia coli,” Biochimica et Biophysica Acta, vol. 1210, no. 2, pp. 123–145, 1994. View at: Publisher Site | Google Scholar
  2. C. C. DiRusso, P. N. Black, and J. D. Weimar, “Molecular inroads into the regulation and metabolism of fatty acids, lessons from bacteria,” Progress in Lipid Research, vol. 38, no. 2, pp. 129–197, 1999. View at: Publisher Site | Google Scholar
  3. D. P. Clark and J. E. Cronan Jr., “Two-carbon compounds and fatty acids as carbon sources,” in Escherichia coli and Salmonella: Cellular and Molecular Biology, F. C. Neidhardt, R. Curtiss III, J. L. Ingraham et al., Eds., pp. 343–357, ASM Press, Washington, DC, USA, 1996. View at: Google Scholar
  4. C. C. DiRusso, A. K. Metzger, and T. L. Heimert, “Regulation of transcription of genes required for fatty acid transport and unsaturated fatty acid biosynthesis in Escherichia coli by FadR,” Molecular Microbiology, vol. 7, no. 2, pp. 311–322, 1993. View at: Publisher Site | Google Scholar
  5. J. W. Campbell and J. E. Cronan Jr., “Escherichia coli FadR positively regulates transcription of the fabB fatty acid biosynthetic gene,” Journal of Bacteriology, vol. 183, no. 20, pp. 5982–5990, 2001. View at: Publisher Site | Google Scholar
  6. N. Raman, P. N. Black, and C. C. DiRusso, “Characterization of the fatty acid-responsive transcription factor FadR. Biochemical and genetic analyses of the native conformation and functional domains,” Journal of Biological Chemistry, vol. 272, no. 49, pp. 30645–30650, 1997. View at: Publisher Site | Google Scholar
  7. M.-J. Han and S. Y. Lee, “The Escherichia coli proteome: past, present, and future prospects,” Microbiology and Molecular Biology Reviews, vol. 70, no. 2, pp. 362–439, 2006. View at: Publisher Site | Google Scholar
  8. A. Matin, “Starvation promoters of Escherichia coli. Their function, regulation, and use in bioprocessing and bioremediation,” Annals of the New York Academy of Sciences, vol. 721, pp. 277–291, 1994. View at: Publisher Site | Google Scholar
  9. S. J. Park and S. Y. Lee, “Identification and characterization of a new enoyl coenzyme a hydratase involved in biosynthesis of medium-chain-length polyhydroxyalkanoates in recombinant Escherichia coli,” Journal of Bacteriology, vol. 185, no. 18, pp. 5391–5397, 2003. View at: Publisher Site | Google Scholar
  10. S. C. Makrides, “Strategies for achieving high-level expression of genes in Escherichia coli,” Microbiological Reviews, vol. 60, no. 3, pp. 512–538, 1996. View at: Google Scholar
  11. J. Sambrook, E. F. Fritsch, and T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 1989.
  12. U. K. Laemmli, “Cleavage of structural proteins during the assembly of the head of bacteriophage T4,” Nature, vol. 227, no. 259, pp. 680–685, 1970. View at: Publisher Site | Google Scholar
  13. M.-J. Han, J. W. Lee, and S. Y. Lee, “Enhanced proteome profiling by inhibiting proteolysis with small heat shock proteins,” Journal of Proteome Research, vol. 4, no. 6, pp. 2429–2434, 2005. View at: Publisher Site | Google Scholar
  14. M. M. Bradford, “A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein dye binding,” Analytical Biochemistry, vol. 72, no. 1-2, pp. 248–254, 1976. View at: Publisher Site | Google Scholar
  15. J. W. Lee, S. Y. Lee, H. Song, and J.-S. Yoo, “The proteome of Mannheimia succiniciproducens, a capnophilic rumen bacterium,” Proteomics, vol. 6, no. 12, pp. 3550–3566, 2006. View at: Publisher Site | Google Scholar
  16. M.-J. Han, S. S. Yoon, and S. Y. Lee, “Proteome analysis of metabolically engineered Escherichia coli producing poly(3-hydroxybutyrate),” Journal of Bacteriology, vol. 183, no. 1, pp. 301–308, 2001. View at: Publisher Site | Google Scholar
  17. H. Nikaido, “Outer membrane,” in Escherichia coli and Salmonella: Cellular and Molecular Biology, F. C. Neidhardt, R. Curtiss III, J. L. Ingraham et al., Eds., pp. 29–47, ASM Press, Washington, DC, USA, 1996. View at: Google Scholar
  18. J. Neuhard and R. A. Kelln, “Biosynthesis and conversions of pyrimidines,” in Escherichia coli and Salmonella: Cellular and Molecular Biology, F. C. Neidhardt, R. Curtiss III, J. L. Ingraham et al., Eds., pp. 580–599, ASM Press, Washington, DC, USA, 1996. View at: Google Scholar
  19. E. C. C. Lin, “Dissimilatory pathways for sugars, polyols, and carboxylates,” in Escherichia coli and Salmonella: Cellular and Molecular Biology, F. C. Neidhardt, R. Curtiss III, J. L. Ingraham et al., Eds., pp. 307–342, ASM Press, Washington, DC, USA, 1996. View at: Google Scholar
  20. F. X. Quintilla, L. Baldoma, J. Badia, and J. Aguilar, “Aldehyde dehydrogenase induction by glutamate in Escherichia coli. Role of 2-oxoglutarate,” European Journal of Biochemistry, vol. 202, no. 3, pp. 1321–1325, 1991. View at: Publisher Site | Google Scholar
  21. S. Y. Lee, “High cell-density culture of Escherichia coli,” Trends in Biotechnology, vol. 14, no. 3, pp. 98–105, 1996. View at: Publisher Site | Google Scholar
  22. J. H. Choi, K. J. Jeong, S. C. Kim, and S. Y. Lee, “Efficient secretory production of alkaline phosphatase by high cell density culture of recombinant Escherichia coli using the Bacillus sp. endoxylanase signal sequence,” Applied Microbiology and Biotechnology, vol. 53, no. 6, pp. 640–645, 2000. View at: Publisher Site | Google Scholar
  23. K. J. Jeong and S. Y. Lee, “High-level production of human leptin by fed-batch cultivation of recombinant Escherichia coli and its purification,” Applied and Environmental Microbiology, vol. 65, no. 7, pp. 3027–3032, 1999. View at: Google Scholar
  24. V. Chauhan, A. Singh, S. M. Waheed, S. Singh, and R. Bhatnagar, “Constitutive expression of protective antigen gene of Bacillus anthracis in Escherichia coil,” Biochemical and Biophysical Research Communications, vol. 283, no. 2, pp. 308–315, 2001. View at: Publisher Site | Google Scholar
  25. K. R. Emslie, J. M. Miller, M. B. Slade, P. R. Dormitzer, H. B. Greenberg, and K. L. Williams, “Expression of the rotavirus SA11 protein VP7 in the simple eukaryote Dictyostelium discoideum,” Journal of Virology, vol. 69, no. 3, pp. 1747–1754, 1995. View at: Google Scholar

Copyright © 2008 Mee-Jung Han et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.