BioMed Research International / 2010 / Article / Tab 2

Research Article

Increasing a Robust Antigen-Specific Cytotoxic T Lymphocyte Response by FMDV DNA Vaccination with IL-9 Expressing Construct

Table 2

Target gene primers.

Target genePrimers

𝛽 -actin 5 -TGACGGGGTCACCCACACTGTGCCCATCTA
3 -CTAGAAGCATTTGCGGTGGACGATGGAGGG
BCL-2 5 -GGCTACGAGTGGGATGCT
3 -GGGTCATGTGTGTGGAGAG
BCL-XL 5 -CGATGAGTTTGAACTGCG
3 -CACCTAGAGCCTTGGATCC
BAX 5 -CTGCAGAGGATGATTGCTGA
3 -CCAACATTGCATGGTGCTAC
BLF-1 5 -CAGGGAAGATGGCTGAGTCT
3 - TTCTGCCGTATCCATTCTCC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.