BioMed Research International / 2012 / Article / Tab 2

Research Article

Effective Silencing of Sry Gene with RNA Interference in Developing Mouse Embryos Resulted in Feminization of XY Gonad

Table 2

Primers used for real-time RT-PCR analysis.

GenesPrimer namePrimer sequences 5′→3′

SrySry-FAGCTCTTACACTTTAAGTTTTGAC
Sry-RGCAGCTCTACTCCAGTCTTGCC
Wt1(−KTS)Wt1(−KTS)-FTACCTTAAAGGGCCACGGTAT
Wt1(−KTS)-SGAAGGGCTTTTCACCTGTATGA
Wt1(+KTS)Wt1(+KTS)-FGCTGGGAGCTCCAGCTCAGT
Wt1(+KTS)-RGGGCTTTTCACTTGTTTTAC
Sox9Sox9-FGGTGCTGAAGGGCTACGCTGGACG
Sox9-RGGCTGGTACTTGTAATCGGGTGGTC
Gata4Gata4-FCGAGGGTGAGCCTGTATGTAA
Gata4-RTGGCCTGCGATGTCTGAGTG
AmhAmh-FTCCTACATCTGGCTGAAGTGATATGGGAGC
Amh-RCTCAGGGTGGCACCTTCTCTGCTTGGTTGA
Sf1Sf1-FTGGTGTCCAGTGTCCACCCTTAT
Sf1-RTCCGTCACGTGTAATGCTTGT
Dax1Dax1-FAGAGTATGCCTATCTGAAAGGGACCGTG
Dax1-RACGACATCGCTATTGATGAATCTCAGCA
β-actinβ-actin-FAACCCTAAGGCCAACCGTG
β-actin-RCAGGATTCCATACCCAAGAAGG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.