BioMed Research International / 2012 / Article / Tab 1

Research Article

In Vivo Testing of MicroRNA-Mediated Gene Knockdown in Zebrafish

Table 1

Sequences of miRNAs and their respective targets.

Name of miRNATarget exonmiRNA sequence

zerg2 miRNA 1 (top)9TGCTGAACCCTTGAAAGCTTTACAGCGTTTTGGCCACTGACTGACGCT
GTAAATTTCAAGGGTT
zerg2 miRNA 1 (bottom)9CCTGAACCCTTGAAATTTACAGCGTCAGTCAGTGGCCAAAACGCTGT
AAAGCTTTCAAGGGTTC
zerg2 miRNA 2 (top)14TGCTGTTCTGTAGGAGACGTCACTGAGTTTTGGCCACTGACTGACTCA
GTGACCTCCTACAGAA
zerg2 miRNA 2 (bottom)14CCTGTTCTGTAGGAGGTCACTGAGTCAGTCAGTGGCCAAAACTCAGT
GACGTCTCCTACAGAAC
zerg3 miRNA 1 (top)8TGCTGATCAGAGAGCCAATAAGCATGGTTTTGGCCACTGACTGACCA
TGCTTAGGCTCTCTGAT
zerg3 miRNA 1 (bottom)8CCTGATCAGAGAGCCTAAGCATGGTCAGTCAGTGGCCAAAACCATGC
TTATTGGCTCTCTGATC
zerg3 miRNA 2 (top)15TGCTGTGGACAGAGAGTCTGGAGACTGTTTTGGCCACTGACTGACAG
TCTCCACTCTCTGTCCA
zerg3 miRNA 2 (bottom)15CCTGTGGACAGAGAGTGGAGACTGTCAGTCAGTGGCCAAAACAGTCT
CCAGACTCTCTGTCCAC
zerg2 miRNA 1 target (top)9TCGAGGCTGTAAAGCTTTCAAGGGTTcT
zerg2 miRNA 1 target (bottom)9CTAGAgAACCCTTGAAAGCTTTACAGCc
zerg2 miRNA 2 target (top)14TCGAGTCAGTGACGTCTCCTACAGAAcT
zerg2 miRNA 2 target (bottom)14CTAGAgTTCTGTAGGAGACGTCACTGAc
zerg3 miRNA 1 target (top)8TCGAGCATGCTTATTGGCTCTCTGATcT
zerg3 miRNA 1 target (bottom)8CTAGAgATCAGAGAGCCAATAAGCATGc
zerg3 miRNA 2 target (top)15TCGAGACCAGGATGACGGCTGATATAcT
zerg3 miRNA 2 target (bottom)15CTAGAgTATATCAGCCGTCATCCTGGTc