BioMed Research International / 2013 / Article / Tab 2

Research Article

A Pipeline with Multiplex Reverse Transcription Polymerase Chain Reaction and Microarray for Screening of Chromosomal Translocations in Leukemia

Table 2

Chimeric primers used in the multiplex RT-PCR.

Primer namePrimer composition (size)aSequence ( to )

ETO_RD14289_SP6_614 (18)ATTTAGGTGACACTATAGA GAACTCTTTCTCCTATCT
RARA_RX06538_SP6_696 (16)ATTTAGGTGACACTATAGA CGGTCGTTTCTCACAG
MYH11-A_RD10667_SP6_2271 (18)ATTTAGGTGACACTATAGA TTGCGTAGCTGCTTGATG
MYH11-DE_RD10667_SP6_1374 (15)ATTTAGGTGACACTATAGA GCAGGCTGTTCCGCT
AML1_RD43969_SP6_731 (17)ATTTAGGTGACACTATAGA CACGGAGCAGAGGAAGT
PBX1_RM86546_SP6_657 (19)ATTTAGGTGACACTATAGA TCGCAGGAGATTCATCACG
TAL1_RS53245_SP6_257 (15)ATTTAGGTGACACTATAGA CGTCCCTCTAGCTGG
ABL_RX16416_SP6_576 (17)ATTTAGGTGACACTATAGA AGCTGCCATTGATCCCG
AF9_RL13744_SP6_1910 (20)ATTTAGGTGACACTATAGA TTCTTGATGCATCCAGTTGT
ENL_RD14539_SP6_301 (20)ATTTAGGTGACACTATAGA GACCACCTTCTCCACGAAGT
ELL_RU16282_SP6_461 (17)ATTTAGGTGACACTATAGA GTAGCGGCCTCCAGCCT
AF6_RU02478_SP6_360 (18)ATTTAGGTGACACTATAGA AATCTGCCTTCCCGATCA
AF10-A_RU13948_SP6_2384 (19)ATTTAGGTGACACTATAGA CACTGCCTCTCCAAAAGCT
AF10-B_RU13948_SP6_1146 (18)ATTTAGGTGACACTATAGA TGACCTGAGCTGTGAGCT
AF4_RL13773_SP6_1674 (18)ATTTAGGTGACACTATAGA TCGAGCATGGATGACGTT
GUS_RM15182_SP6_2057 (18)ATTTAGGTGACACTATAGA TGCCGTGAACAGTCCAGG
AML1_FD43969_T7_903 (22)TAATACGACTCACTATAGGGA CCAGGTTGCAAGATTTAATGAC
PML-L_FM73778_T7_1438 (19)TAATACGACTCACTATAGGGA CAGTGTACGCCTTCTCCATCA
PML-S_FM73778_T7_927 (25)TAATACGACTCACTATAGGGA GTGCGCCAGGTGGTAGCTC
PLZF_FZ19002_T7_1092(21)TAATACGACTCACTATAGGGA CCACAAGGCTGACGCTGTATT
NPM1_FX16934_T7_160 (25)TAATACGACTCACTATAGGGA ACGAAGGCAGTCCAATTAAAGTAAC
CBFB_FL20298_T7_267 (22)TAATACGACTCACTATAGGGA TTTGAAGGCTCCCATGATTCTG
TEL_FU11732_T7_871 (23)TAATACGACTCACTATAGGGA CACTCCGTGGATTTCAAACAGTC
E2A_FM31222_T7_1243 (22)TAATACGACTCACTATAGGGA AAGATAGAAGACCACCTGGACG
SIL_FM74558_T7_24 (19)TAATACGACTCACTATAGGGA CGACCCCAACGTCCCAGAG
BCR-190_FX02596_T7_1590 (20)TAATACGACTCACTATAGGGA CGCTCTCCCTCGCAGAACT
BCR-210_FX02596_T7_2952 (24)TAATACGACTCACTATAGGGA GAGTCACTGCTGCTGCTTATGTC
BCR-230_FX02596_T7_3682 (19)TAATACGACTCACTATAGGGA CCAAGGTGCCCTACATCGT
MLL_FL04284_T7_3916 (20)TAATACGACTCACTATAGGGA CCGCCTCAGCCACCTACTAC
GUS_FM15182_T7_1786 (20)TAATACGACTCACTATAGGGA GGAATTTTGCCGATTTCATG
T7TAATACGACTCACTATAGGGA
SP6ATTTAGGTGACACTATAGA
SP6-biotinbiotin-ATTTAGGTGACACTATAGA

_R: reverse primer, _F: forward primer.
Primer composition was given with gene accession number plus universal gene (T7 or SP6), the starting position on the gene, and total length in brackets.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.