BioMed Research International / 2013 / Article / Tab 3

Research Article

A Pipeline with Multiplex Reverse Transcription Polymerase Chain Reaction and Microarray for Screening of Chromosomal Translocations in Leukemia

Table 3

Sequence of oligonucleotide probes used on the microarray.

Chromosome aberrationGene nameFusion variantsProbe nameSequence ( to )Position on microarray

t(8;21)(q22;q22)AML1-ETO AML1-ETO AML1-ETOCCCGAGAACCTCGAAATCGTACTGAGAAGA-1abc
AML1ex5CTCAGGTTTGTCGGTCGAAGTGGAAGAGGA-2abc
ETOGCCAGACTCACCTGTGGATGTGAAGACGCAAA-3abc

t(15;17)(q22;q21)PML-RARA L-formPML-RARA-LCCGGGGAGGCAGCCATTGAGACCCAGAGB-1abc
S-formPML-RARA-SCACCCAGGGGAAAGCCATTGAGACCCAGAGB-2abc
PML-LCAGAAGAGGAAGTGCAGCCAGACCCAGTGCCB-3abc
PML-SAGAGGATGAAGTGCTACGCCTCGGACCAGB-4abc
RARACCCTCTACCCCGCATCTACAAGCCTTGCTTB-5abc

t(11;17)(q23;q21)PLZF-RARA PLZF-RARA PLZF-RARACTTACTGGCTCATTCAGCCATTGAGACCCAGAC-1abc
PLZFGGGATGAAGACGTACGGGTGCGAGCTCTGC-2abc

t(5;17)(q35;q22)NPM1-RARA L-formNPM1-RARA-L-1AGGAGGAGGATGTGAACAGGGTTTTATTTATGAAC-3abc
S-formNPM1-RARA-L-2GTTGGAAATTGGCAGCCATTGAGACCCAGAC-4abc
NPM1-RARA-SGTGGACAGCACTTAGTAGCCATTGAGACCCAGAC-5abc
NPM1ACACCACCAGTGGTCTTAAGGTTGAAGTGTGGC-6abc

inv(16)(p13q22)CBFB-MYH11 ACBFB-MYH11-ACGGGAGGAAATGGAGGTCCATGAGCTGGAGAD-1abc
DCBFB-MYH11-DCGGGAGGAAATGGAGAATGAAGTTGAGAGCGD-2abc
ECBFB-MYH11-ECGGGAGGAAATGGAGGCCAAGGCGAACCD-3abc
CBFBCACGCGAATTTGAAGATAGAGACAGGTCTCAD-4abc
MYH11-AACCCAGATGGAGGAGATGAAGACGCAGCD-5abc
MYH11-DEGACACCCAGGAGTTGCTTCAAGAAD-6abc

t(12;21)(p13;q22)TEL-AML1 TEL-AML1ex2TEL-AML1ex2ATTGGGAGAATAGCAGAATGCATACTTGGAATGG-1abc
TEL-AML1ex3TEL-AML1ex3ATTGGGAGAATAGCAGATGCCAGCACGAGCG-2abc
TELATCGGGAAGACCTGGCTTACATGAG-3abc
AML1ex3GCCGCTTCACGCCGCCTTCCACCGCG-4abc

t(1;19)(q23;p13)E2A-PBX1 IE2A-PBX1-ICCCGACTCCTACAGTGTTTTGAGTATCCGAGGH-1abc
IaE2A-PBX1-IaTACAGTGATGAAAGTGTTCGGTCACCTGGAACCTTTTTGH-2abc
E2ACCTCAGGTTTCACCGGCCCCATGTCACTH-3abc
PBX1TGGACAACATGCTGTTAGCGGAAGGCGTGGH-4abc

t(9;22)(q34;q11)BCR-ABL p190p190TTCCATGGAGACGCAGAAGCCCTTCAGCGGCJ-1abc
p210 b2a2p210-b2a2TGACCATCAATAAGGAAGAAGCCCTTCAGCGK-1abc
p210 b3a2p210-b3a2CTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCK-2abc
p230p230AGCCTTCGACGTCAAAGCCCTTCAGCGK-4abc
BCR190GGGCGTCCGCAAGACCGGGCAGATCTGGJ-2abc
BCR210AGAACATCCGGGAGCAGCAGAAGAAGTGTTTK-3abc
BCR230TGGAGGAGATCGAGCGCCGAGGCATGGAGGK-5abc
ABLCCAAGGCTGGGTCCCAAGCAACTACATCACGK-6abc

del(1)(p32;p32)SIL-TAL1 ISIL-TAL1-ICGCGGAAGTTGCGGATGACCGAGCGGCI-1abc
IISIL-TAL1-IICGCGGAAGTTGCGATCGCCCAGGACCAI-2abc
IIISIL-TAL1-IIICCTCCCAAAATGCTGATCGCCCAGGACCAI-3abc
SILGGCTCCCGCTCCTACCCTGCAAACAGAI-4abc
TAL1GCCGAGCGAGGCGGCTCGCAGTGACCCI-5abc

t(4;11)(q21;q23)MLL-AF4 MLLCCCAAAACCACTCCTAGTGAGCCCAF-1abc
AF4TCAAAAACTCACTCAAATTCTCAGCAAGF-2abc

t(9;11)(p22;q23)MLL-AF9 AF9ACCTGGAAACATCTGGAACATCCTGAGGAE-1abc

t(11;19)(q23;p13.3)MLL-ENL ENLGGGTTCACTCACGACTGGATGGTGTTTGTCCGE-2abc

t(11;19)(q23;p13.1)MLL-ELL ELLCCAGCAGTATGTCTCCAGTCATGGGGAAGTE-3abc

t(6;11)(q27;q23)MLL-AF6 AF6TTCGACCTGATATGCGAATGCTGTCCTCTCE-4abc

t(10;11)(p12;q23)MLL-AF10 A:2222AF10-AGCTTACAGATTCGCTATGATCAACCAGGCAE-5abc
B:979AF10-BGTTTCAGAGACTAGAGGGTCAGAGGGCAE-6abc

GUS GUSCAGTCACCGACGAGAGTGCTGGGGAL-1abc, 3abc, 5abc

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.