Table 1: Primers for RT-PCR.

GeneAccession numberForward (5′-3′)Reverse (5′-3′)

BMP4 NM_007554.1gaggagtttccatcacgaagagctctgccgaggagatca
Sox9 NM_011448.2cagcaagactctgggcaag tccacgaagggtctcttctc
aggrecan NM_007424.1ccagcctacaccccagtggagggtgggaagccatgt
Col2a1 NM_031163.2agtaccggagctcgaggaggatcacccttggcaccag
Noggin NM_008711cggccagcactatctacacagttcgatgaggtccaccaag
Gremlin 1 NM_011824gaggacccacggaagtgacctcagctgttggcagtagg
Follistatin NM_008046tggattagcctatgagggaaagtggaatcccataggcatttt
Cathepsin H NM_007801.1gaggaagattcaagcccacaaaaactggttcaacgccatt