BioMed Research International / 2013 / Article / Tab 1

Research Article

Downregulation of DLC-1 Gene by Promoter Methylation during Primary Colorectal Cancer Progression

Table 1

Primers for MS-HRMA, HRMA, and real-time PCR.

UsagePrimerSequence (5′–3′)Amplicon (bp)

MS-HRMAMS-HRM-FTCGTTACGGTTTTAGAAAGAAA 134
MS-HRM-RTTCGCTCCCAACCAAAACATAA

HRMAKRAS-FCTGAATATAAACTTGTGGTAGTTGGA59
KRAS-RTATCGTCAAGGCACTCTTGC
BRAF-FGGTGATTTTGGTCTAGCTACAG147
BRAF-RAGTAACTCAGCAGCATCTCAGG

Real-time PCRGAPDH-FGAAGGTGAAGGTCGGAGTCA226
GAPDH-RGAAGATGGTGATGGGATTTC
DLC-1-FACCTGATCACGCAACAGTGAAACA191
DLC-1-RAGACGCCTGCATAGAGCCTCA

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.