Expression of Bmi-1 in Pediatric Brain Tumors as a New Independent Prognostic Marker of Patient Survival

Farivar, Shirin; Zati Keikha, Reza; Shiari, Reza; Jadali, Farzaneh

doi:https://doi.org/10.1155/2013/192548

BioMed Research International

On this page

Abstract Introduction Materials and Methods Results Discussion Conclusion Acknowledgments References Copyright Related Articles

Special Issue

Cancer Monitoring Methods

View this Special Issue

Research Article | Open Access

Volume 2013 | Article ID 192548 | https://doi.org/10.1155/2013/192548

Expression of Bmi-1 in Pediatric Brain Tumors as a New Independent Prognostic Marker of Patient Survival

Shirin Farivar,^1,2Reza Zati Keikha,¹Reza Shiari,^3,4and Farzaneh Jadali^3,4

Academic Editor: Natasa Tosic

Received02 Apr 2013

Accepted18 Jun 2013

Published28 Jul 2013

Abstract

Objectives. The B-cell-specific moloney leukemia virus insertion site 1 (the Bmi-1) gene is an important member in the family of polycomb group (PcG) genes that plays an oncogenic role in several types of cancer, but it’s expression as a prognostic marker in pediatric brain tumors has not been indicated. Materials and Methods. The Bmi-1 gene expression, clinic pathological and prognostic significance in a series of pediatric brain tumors were examined by real-time PCR method in 56 pediatric brain tumors. Results. The Bmi-1 gene expression in various types of pediatric brain tumors compared to that in normal brain tissue was 4.85-fold. The relative expression varied from 8.64-fold in ependymomas to 2.89-fold in other types. Expression level in high-grade tumors compared to that in low-grade tumors was 2.5 times. In univariate survival analysis of the pediatric brain tumors, a significant association of high expression of the Bmi-1 with patient survival was demonstrated. In multivariate analysis, the Bmi-1 high expression provided significant independent prognostic factors. Conclusion. Increased expression of the Bmi-1 in pediatric brain tumors may be important in the acquisition of an aggressive phenotype. In addition, it can be used as a strong and independent molecular marker of prognosis in pediatric brain tumors.

1. Introduction

Brain tumors are the most common solid tumors and the second most frequent malignancy after leukemia in children [1]. So far, little is known about molecular mechanisms associated with these types of tumors. These tumors are the genotypically and phenotypically different from adult brain tumors [2, 3]. Five-year survival rate for children with brain tumors is estimated to be approximately 75% [4]. Gliomas comprises approximately 60% of cases among pediatric brain tumors, whereas the remaining 40% are heterogeneous and consist of medulloblastomas and other embryonal tumors (26%), craniopharyngiomas (4%), pineal tumors (1%), meningiomas (1%), and others [5]. Identification of molecular markers associated with pediatric brain tumors provides suitable conditions for treatment of these tumors. The B-cell-specific moloney leukemia virus insertion site 1 (Bmi-1) gene is an important member of the PRC1 complex. Members of PRC1 complex have been identified as transcriptional repressors [6–8]. The Bmi-1 mediates gene silencing by regulating chromatin structure, and it is essential for the maintenance and self-renewal of both haematopoietic and neural stem cells [9, 10]. This function of Bmi-1 depends on its ability to repress the INK4A locus. The INK4A locus as a target of Bmi-1 is a critical regulator of the p53 and Rb tumor suppressor pathways [11]. Thus, Bmi-1 would be the determining factor in the control of cell cycle. Overexpression of the Bmi-1 was found in high-grade B-cell non-Hodgkin Lymphomas (NHLs) [12], colorectal cancers [13], ovarian cancer, breast, cervical [14], skin cancer [15], neuroblastoma [16], and nonsmall cell lung cancer (NSCLC) [11]. Bmi-1 is known to be a useful prognostic marker in many cancers, including nasopharyngeal carcinoma [17], bladder cancer [18], gastric cancer [19], and others. The Bmi-1 expression as a prognostic marker in pediatric brain tumors has not been indicated. In this study, the Bmi-1 gene expression, clinicopathological, and prognostic significance in a series of pediatric brain tumors were examined.

2. Materials and Methods

2.1. Patients

A total of 56 pediatric brain tumors were obtained from archives of paraffin-embedded tissues between 2006 and 2012 at the Department of Pathology in Mofid Children’s Hospital, Shahid Beheshti University of Medical Sciences. The selection of patients was based on distinctive pathologic diagnosis, availability of tissue, follow-up data, and not receiving radiation or chemotherapy. Pathological parameters and patient survival data were collected. These patients included 53.5% male and 46.5% female with mean age of 3.28 years. The pediatric brain tumor cases encompassed 20% medulloblastoma, 34% astrocytomas, 28% ependymomas, and 18% others (Primitive Neuro Ectodermal Tumors (PNET), gangliogliomas, and oligodendrogliomas). Clinicopathological characteristics of these patients were detailed in Table 1.

2.2. RNA Extraction and cDNA Synthesis

This protocol was used for extraction of total RNA from FFPE (formalin-fixed paraffin-embedded tissues) specimens [20]. Tissue sections were deparaffinized by 1.5 mL xylene at 37°C for 20 min and incubated in 1.5 mL 100% ethanol at 37°C for 30 min. 600 μL of RNA lysis buffer containing 10 mmol/L TrisHcl (pH8), 0.1 mmol/L EDTA (pH8), and 2% SDS (pH7.3) with 50 μL of 60 mg/mL proteinase K (Fermentas, Vilnius, and Lithuania) is added and incubated at 60°C for 16–20 h. Then total RNA was extracted by phenol chloroform method. The RNA concentration was measured using the Nano Drop 2000 (Thermo scientific, USA). Total RNA treated with DNase I (Invitrogen, Paisley, UK) to eliminate genomic DNA, for cDNA synthesis cDNA Accu Power Cycle Script RT PreMix (BioneerCo. Chungwon, South Korea), was used according to the manufacturer’s instructions.

2.3. Real-Time PCR

Specific primers were designed for the Bmi-1 and Beta-actin as an internal control (Gen Bank accession numbers: NM-005180.8, NM-001101.3, Bmi-1 Forward: CTGCAGCTCGCTTCAAGATG. Bmi-1 Reverse: CACACACATCAGGTGGGGAT. Beta-actin Forward: ATGACTTAGTTGCGTTACACC. Beta-actin Reverse: TGCTGTCACCTTCACCGTTC) using oligo 7 software.

Real-time PCR reactions were performed using SYBR Green method with Accu Power Green Star qPCR Master Mix (BioneerCo. Chungwon, South Korea) on a Rotor-Gene 6000 (Corbett Research, Sydney, Australia). PCR was run as follows: 94°C for 10 min, amplification for 40 cycles with denaturation at 94°C for 10 seconds, annealing at 57°C for 10 seconds, and extension at 72°C for 15 seconds. All experiments were repeated in duplicate or triplicate. Relative expression results of real-time PCR were carried out by REST 2009 software (Relative Expression Software Tool, Corbett Research).

2.4. Statistical Analysis

Statistical analysis was implemented by using the SPSS statistical software package (standard version 18.0; SPSS, Chicago, USA). The association of the Bmi-1 gene expression with clinicopathological characteristics of pediatric brain tumor patients was assessed by T test and ANOVA test. The Kaplan Meier method was used for survival analysis, and a log-rank test was used to compare the differences among survival curves. The COX risk ratio model was used for multifactorial analysis on survival, where had statistical significance.

3. Results

3.1. Expression of the Bmi-1 in Pediatric Brain Tumors

The mean gene expression level of the Bmi-1 is used to segregate the patients into a low Bmi-1 gene expression (Bmi-1 expression < mean; ) and a high Bmi-1gene expression (Bmi-1 expression > mean; ). The Bmi-1 gene expression in various types of pediatric brain tumors compared to normal brain tissue was 4.85-fold (). The relative expression varied from 8.64-fold in ependymomas to 2.89-fold in other types. Expression level in high-grade tumors compared to low-grade tumors was 2.5 times (6.85 versus 2.75-fold change). The Bmi-1 gene expression in embryonal and gliomas tumors was 3.59- and 5.54-fold, respectively. The T test showed a significant difference between the Bmi-1 gene expression, embryonal/gliomas tumor, and high-grade/low-grade tumor (, Table 1).

3.2. Relationship between Clinicopathological Characteristics, Bmi-1 Gene Expression, and Pediatric Brain Tumor Patient Survival

In univariate survival analysis, the cumulative survival Kaplan-Meier curves were calculated according to the test. Differences in survival time were examined by Log-rank test. Kaplan-Meier curves showed a significant influence of the Bmi-1 gene expression (), high-grade/low-grade () on patient survival. The mean survival time for patient with high expression levels of the Bmi-1 was 20.3 months compared to 39.6 months for patients with low expression levels of the Bmi-1. The mean survival time was 24.6 months in high-grade tumors and 34.4 months in low-grade tumors. The time for M1, M2, M3, and M4 tumor stage was 37.6, 29.5, 24.9, and 20.1 months, respectively (Table 2). The comparison between survival curves of high expressions and low expression of the Bmi-1 is shown in Figure 1.

3.3. Independent Prognostic Factors of Pediatric Brain Tumors

3.3.1. Multivariate Cox Regression Analysis

The Bmi-1 expression and other clinicopathological parameters that were significant in univariate analysis (high grade/low grade) were examined in multivariate analysis. The results of this analysis showed that the Bmi-1 gene expression (B = 0.827, standard error = 0.403, Wald = 4.207, relative rate = 2.287, and ) and high grade/low grade (B = 0.751, standard error = 0.393, Wald = 3.647, relative rate = 2.118, and ) were independent prognostic factors of a patient with pediatric brain tumor.

4. Discussion

Pediatric brain tumors are the most common solid tumors of childhood which approximately 1,500 patients suffer from every year in the United States. These tumors are second in order after leukemia in overall cancer incidences and responsible for a high proportion of deaths [21–23]. Considering the high incidence and mortality of patients with pediatric brain tumors identifying a genetic molecular marker that is associated with patient survival is necessary. The gene, the Bmi-1, is an important member in the family of polycomb group genes that participates in the regulation of cell growth and proliferation as transcriptional repressor [6–8]. It is essential for self-renewal of both hematopoietic, neural stem cells and cancer stem cells [9, 10, 24, 25]. The Bmi-1 proto-oncogene has been upregulated in a large number of cancers such as breast cancer [14], skin cancer [15], lymphoma [12], leukemia [26], and other cancers and is known to be a useful prognostic marker in many cancers. As it is so widely expressed, the Bmi-1 expression cannot be used as a specific marker for pediatric brain tumors. This is the first study that evaluates the Bmi-1 gene expression by real-time PCR in various types of pediatric brain tumors in association with clinicopathological and prognostic significance. The results demonstrated that the expression level of the Bmi-1 was high in all types of the pediatric brain tumors, suggesting that the Bmi-1 gene expression is related to the incidence of pediatric brain tumors. A significant increasing expression of the Bmi-1 was observed from high-grade to low-grade tumors. These findings show that upregulated expression of the Bmi-1 in high-grade tumors may acquire phenotypic characteristics of malignant tumor cells. It also shows that at high expression levels, tumors biological behavior gets worse. We found that the expression of the Bmi-1 in gliomas tumors was significantly larger than embryonal tumors. It suggests that the Bmi-1 gene plays some roles in the progression of gliomas tumors. Therefore, clinically, the measurement of the Bmi-1 gene expression could be helpful in diagnosis of gliomas from embryonal tumors. Moreover, we found that the Bmi-1 gene expression and high- or low-grade tumors were predictor of survival as evidenced by Kaplan-Meier curves and long rank test. Multivariate Cox proportional hazards regression analysis demonstrated that high expression of the Bmi-1 in pediatric brain tumors was a predictor of short overall survival, independent of high or low grade tumors. These findings show the important role of the Bmi-1 in pediatric brain tumors. Aberrant expression of the Bmi-1 in this tumors would change the composition of the PcG complex to proliferation cell cycle by transcription repressor of some genes such as p16Ink4A and p19Arf involved in tumor suppression, resulting in oncogenic effects, because the amounts of the Bmi-1 in the PcG complex determine its biochemical and biologic functions [27]. Moreover, overexpression of the Bmi-1 correlated with overexpression of PATCHED-1 (PTCH1), which is a reliable indicator of activation of the Shh pathway [27]. The abnormal activation of the Shh pathway is important in a subset of pediatric brain tumors [28]. Also it has been postulated that the Bmi-1 plays a role in self-renewal of cancer stem cells [24], so high expression of the Bmi-1 correlates with greater capacity of self-renewal and might represent the tumorigenesis and poor prognosis in pediatric brain tumors. We observed that data generated from FFPE material are comparable to data extracted from the fresh frozen samples; however, there was no significant association between the gene expression level and the time passed after formalin-fixed paraffin embedding.

5. Conclusion

In this study, to our knowledge, for the first time, we describe the Bmi-1 gene expression in various types of pediatric brain tumors. Our results demonstrated that increased expression of the Bmi-1 in pediatric brain tumors may be important in the acquisition of an aggressive phenotype. In addition, our study introduces the Bmi-1 expression as a strong and independent molecular marker of prognosis in pediatric brain tumors in addition to providing a specific target site for targeting therapy.

Acknowledgments

The authors are very grateful to Pediatric Infectious Research Center of Shahid Beheshti University of Medical Sciences and Mofid Children’s Hospital for the excellent technical assistance.

References

J. Li, T. D. Thompson, J. W. Miller, L. A. Pollack, and S. L. Stewart, “Cancer incidence among children and adolescents in the United States, 2001–2003,” Pediatrics, vol. 121, no. 6, pp. e1470–e1477, 2008.
View at: Publisher Site | Google Scholar
D. Faury, A. Nantel, S. E. Dunn et al., “Molecular profiling identifies prognostic subgroups of pediatric glioblastoma and shows increased YB-1 expression in tumors,” Journal of Clinical Oncology, vol. 25, no. 10, pp. 1196–1208, 2007.
View at: Publisher Site | Google Scholar
T. Sung, D. C. Miller, R. L. Hayes, M. Alonso, H. Yee, and E. W. Newcomb, “Preferential inactivation of the p53 tumor suppressor pathway and lack of EGFR amplification distinguish de novo high grade pediatric astrocytomas from de novo adult astrocytomas,” Brain Pathology, vol. 10, no. 2, pp. 249–259, 2000.
View at: Google Scholar
G. Perilongo, “Considerations on the role of chemotherapy and modern radiotherapy in the treatment of childhood low grade glioma,” Journal of Neuro-Oncology, vol. 75, no. 3, pp. 301–307, 2005.
View at: Publisher Site | Google Scholar
P. Kaatsch, C. H. Rickert, J. Kühl, J. Schüz, and J. Michaelis, “Populationbased epidemiologic data on brain tumors in German children,” Cancer, vol. 92, no. 12, pp. 3155–3164, 2001.
View at: Google Scholar
J. A. Simon and R. E. Kingston, “Mechanisms of Polycomb gene silencing: knowns and unknowns,” Nature Reviews Molecular Cell Biology, vol. 10, no. 10, pp. 697–708, 2009.
View at: Publisher Site | Google Scholar
A. Sparmann and M. Van Lohuizen, “Polycomb silencers control cell fate, development and cancer,” Nature Reviews Cancer, vol. 6, no. 11, pp. 846–856, 2006.
View at: Publisher Site | Google Scholar
V. Orlando, “Polycomb, epigenomes, and control of cell identity,” Cell, vol. 112, no. 5, pp. 599–606, 2003.
View at: Publisher Site | Google Scholar
A. V. Molofsky, R. Pardal, T. Iwashita, I.-K. Park, M. F. Clarke, and S. J. Morrison, “Bmi-1 dependence distinguishes neural stem cell self-renewal from progenitor proliferation,” Nature, vol. 425, no. 6961, pp. 962–967, 2003.
View at: Publisher Site | Google Scholar
I.-K. Park, D. Qian, M. Kiel et al., “Bmi-1 is required for maintenance of adult self-renewing haematopoietic stem cells,” Nature, vol. 423, no. 6937, pp. 302–305, 2003.
View at: Publisher Site | Google Scholar
S. Vonlanthen, J. Heighway, H. J. Altermatt et al., “The bmi-1 oncoprotein is differentially expressed in non-small cell lung cancer and correlates with INK4A-ARF locus expression,” British Journal of Cancer, vol. 84, no. 10, pp. 1372–1376, 2001.
View at: Publisher Site | Google Scholar
F. J. Van Kemenade, F. M. Raaphorst, T. Blokzijl et al., “Coexpression of BMI-1 and EZH2 polycomb-group proteins is associated with cycling cells and degree of malignancy in B-cell non-Hodgkin lymphoma,” Blood, vol. 97, no. 12, pp. 3896–3901, 2001.
View at: Publisher Site | Google Scholar
J. H. Kim, S. Y. Yoon, C.-N. Kim et al., “The Bmi-1 oncoprotein is overexpressed in human colorectal cancer and correlates with the reduced p16INK4a/p14ARF proteins,” Cancer Letters, vol. 203, no. 2, pp. 217–224, 2004.
View at: Publisher Site | Google Scholar
A. Honig, C. Weidler, S. Häusler et al., “Overexpression of polycomb protein BMI-1 in human specimens of breast, ovarian, endometrial and cervical cancer,” Anticancer Research, vol. 30, no. 5, pp. 1559–1564, 2010.
View at: Google Scholar
S. Balasubramanian, K. Lee, G. Adhikary, R. Gopalakrishnan, E. A. Rorke, and R. L. Eckert, “The Bmi-1 polycomb group gene in skin cancer: regulation of function by (-)-epigallocatechin-3-gallate,” Nutrition Reviews, vol. 66, no. 1, pp. S65–S68, 2008.
View at: Publisher Site | Google Scholar
H. Cui, B. Hu, T. Li et al., “Bmi-1 is essential for the tumorigenicity of neuroblastoma cells,” The American Journal of Pathology, vol. 170, no. 4, pp. 1370–1378, 2007.
View at: Publisher Site | Google Scholar
L.-B. Song, M.-S. Zeng, W.-T. Liao et al., “Bmi-1 is a novel molecular marker of nasopharyngeal carcinoma progression and immortalizes primary human nasopharyngeal epithelial cells,” Cancer Research, vol. 66, no. 12, pp. 6225–6232, 2006.
View at: Publisher Site | Google Scholar
Z. K. Qin, J. A. Yang, Y. L. Ye et al., “Expression of Bmi-1 is a prognostic marker in bladder cancer,” BMC Cancer, vol. 9, no. 61, 2009.
View at: Publisher Site | Google Scholar
J.-H. Liu, L.-B. Song, X. Zhang et al., “Bmi-1 expression predicts prognosis for patients with gastric carcinoma,” Journal of Surgical Oncology, vol. 97, no. 3, pp. 267–272, 2008.
View at: Publisher Site | Google Scholar
F. Zhang, Z.-M. Wang, H.-Y. Liu et al., “Application of RT-PCR in formalin-fixed and paraffin-embedded lung cancer tissues,” Acta Pharmacologica Sinica, vol. 31, no. 1, pp. 111–117, 2010.
View at: Publisher Site | Google Scholar
D. Miltenburg, D. F. Louw, and G. R. Sutherland, “Epidemiology of childhood brain tumors,” Canadian Journal of Neurological Sciences, vol. 23, no. 2, pp. 118–122, 1996.
View at: Google Scholar
I. F. Pollack, “Brain tumors in children,” The New England Journal of Medicine, vol. 331, no. 22, pp. 1500–1507, 1994.
View at: Publisher Site | Google Scholar
F. Sala, E. Colarusso, C. Mazza, A. Talacchi, and A. Bricolo, “Brain tumors in children under 3 years of age: recent experience (1987–1997) in 39 patients,” Pediatric Neurosurgery, vol. 31, no. 1, pp. 16–26, 1999.
View at: Publisher Site | Google Scholar
M. Al-Hajj and M. F. Clarke, “Self-renewal and solid tumor stem cells,” Oncogene, vol. 23, no. 43, pp. 7274–7282, 2004.
View at: Publisher Site | Google Scholar
S. K. Singh, I. D. Clarke, T. Hide, and P. B. Dirks, “Cancer stem cells in nervous system tumors,” Oncogene, vol. 23, no. 43, pp. 7267–7273, 2004.
View at: Publisher Site | Google Scholar
M. Sawa, K. Yamamoto, T. Yokozawa et al., “BMI-1 is highly expressed in M0-subtype acute myeloid leukemia,” International Journal of Hematology, vol. 82, no. 1, pp. 42–47, 2005.
View at: Publisher Site | Google Scholar
C. Leung, M. Lingbeek, O. Shakhova et al., “Bmi1 is essential for cerebellar development and is overexpressed in human medulloblastomas,” Nature, vol. 428, no. 6980, pp. 337–341, 2004.
View at: Publisher Site | Google Scholar
J. T. Romer, H. Kimura, S. Magdaleno et al., “Suppression of the Shh pathway using a small molecule inhibitor eliminates medulloblastoma in Ptc1^+/-p53^-/- mice,” Cancer Cell, vol. 6, no. 3, pp. 229–240, 2004.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2013 Shirin Farivar et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

1631

Downloads

1320

Citations