A Guide RNA Sequence Design Platform for the CRISPR/Cas9 System for Model Organism Genomes

Table 1

Analyze of reported targets in human cells in this platform.

Target genes	Guide RNA sequences	Mapping and SNP	bp in loops	AT%	Efficiency	Methods	Reference
Human PVALB	ATTGGGTGTTCAGGGCAGAG	1 places matched on genome: chr22:37196884-37196906(+), with 1 SNPs: rs12483924 (2 bp to 3′ end)	6	45%	6.50%	Surveyor	Cong et al. 2013 [10]
Human PVALB	GTGGCGAGAGGGGCCGAGAT	1 places matched on genome: chr22:37196866-37196888(+), with 3 SNPs: rs3484 (18 bp to 3 ′ end) rs181855770 (10 bp to 3 ′ end) rs9607383 (9 bp to 3 ′ end)	9	30%	ND
Human PVALB	GGGGCCGAGATTGGGTGTTC	1 places matched on genome: chr22:37196875-37196897(+), with 2 SNPs: rs181855770 (19 bp to 3 ′ end) rs9607383 (18 bp to 3 ′ end)	9	35%	ND
Human AAVS1	GGGGCCACTAGGGACAGGAT	1 places matched on genome: chr19:55627117-55627139(−), with 0 SNPs	8	35%	8.07%	HR	Mali et al. 2013 [9]
Human AAVS1	GTCCCCTCCACCCCACAGTG	2 places matched on genome:chr19:55627136-55627158(−), with 0 SNP schr4:108975634-108975656(+), with 1 SNPs: rs115503552 (7 bp to 3 ′ end)	7	30%	3.26%
Human VEGFA	GGGTGGGGGGAGTTTGCTCC	1 places matched on genome: chr6:43737291-43737313(−), with 1 SNPs: rs12210204 (1 bp to 3 ′ end)	11	30	26%	T7EI assay	Fu et al. 2013 [21]
Human VEGFA	GACCCCCTCCACCCCGCCTC	1 places matched on genome: chr6:43738556-43738578(−), with 0 SNPs	4	20	50%
Human VEGFA	GGTGAGTGAGTGTGTGCGTG	1 places matched on genome: chr6:43737454-43737476(+), with 0 SNPs	12	40	49.40%

∗ND represents not detectable. Italic font represents low efficient gRNAs within the same gene group.