BioMed Research International / 2013 / Article / Tab 1

Research Article

DHA Inhibits Protein Degradation More Efficiently than EPA by Regulating the PPARγ/NFκB Pathway in C2C12 Myotubes

Table 1

Oligonucleotide polymerase chain reaction primers.

Gene1Accession numberSourcePrimer sequences ( )Product size (bp)ta2 (°C)Amplification Efficiency (%)

PPARγNM011146MusATGGAGCCTAAGTTTGAGTT
CAGCAGGTTGTCTTGGATGT
1535898
β-actin NM007393MusCAGTGCGTGCTAAAGGGAGA
CGCTCGTTGCCAATAGTGAT
1485997

PPARγ: Peroxisome proliferator-activated receptor γ.
2ta, optimal PCR annealing temperature.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.