Table of Contents Author Guidelines Submit a Manuscript
BioMed Research International
Volume 2013 (2013), Article ID 759361, 6 pages
Research Article

The SDF-1 A Genetic Variation Is Correlated with Susceptibility of Asthma in Iranian Patients

1Immunology Research Center, School of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
2Molecular Medicine Research Center, Rafsanjan University of Medical Sciences, Rafsanjan 77175-835, Iran
3Physiology, Pharmacology Research Center, Rafsanjan University of Medical Sciences, Rafsanjan 77175-835, Iran
4Department of Immunology, Rafsanjan University of Medical Sciences, Rafsanjan 77175-835, Iran
5Department of Infectious Diseases, Rafsanjan University of Medical Sciences, Rafsanjan 77175-835, Iran
6Faculty of Nursing, Rafsanjan University of Medical Sciences, Rafsanjan 77175-835, Iran
7Kerman University of Medical Sciences, Kerman, Iran

Received 28 February 2013; Revised 15 July 2013; Accepted 16 July 2013

Academic Editor: Oliver Haworth

Copyright © 2013 Houshang Rafatpanah et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Background and Aim. Chemokine/receptor axis is a predominant actor of clinical disorders. They are key factors of pathogenesis of almost all clinical situations including asthma. Correspondingly, CXCL12 is involved in the immune responses. Therefore, this study was designed to explore the association between gene polymorphism at position +801 of CXCL12, known as , and susceptibility to asthma in Iranian patients. Material and Methods. In this experimental study, samples were taken from 162 asthma patients and 189 healthy controls on EDTA. DNA was extracted and analyzed for CXCL12 polymorphisms using PCR-RLFP. The demographic information was also collected in parallel with the experimental part of the study by a questionnaire which was designed specifically for this study. Findings. Our results indicated a significant difference ( ) between the A/A, A/G, and G/G genotypes and A and G alleles of polymorphisms at position +801 of CXCL12. We also showed an elevated level of CXCL12 circulating level in Iranian asthma patients. Conclusion. Our findings suggest that (CXCL12) polymorphism plays a role in pathogenesis of asthma. It can also be concluded that circulatory level of CXCL12 presumably can be used as one of the pivotal biological markers in diagnosis of asthma.

1. Introduction

Asthma is characterized as the airways chronic inflammatory disease with mostly airway obstruction, which is accompanied by increased bronchial high responsiveness to various external and internal stimuli. Asthmatic patients suffer from varying symptoms from breathlessness, wheezing, and cough to chest tightness. It is sometimes coupled with allergy, an acquired potency for progression of unwanted reactions that are controlled via immunological mediators [1]. Approximately more than 22 million people are suffering from asthma. Asthma and allergic diseases are believed to follow the pattern of genetic diseases that are caused by the interaction of multiple genes and also environmental stimuli [2].

Although several lines of evidence have indicated the central role of chemokines in regulating multiple aspects of the asthmatic response, the full picture of chemokines’ involvement in allergic airway inflammation, the exact role of specific chemokines at various stages in the evolution of allergic lung inflammation and their regulatory pathways in vivo are only partially identified.

In the process of allergic airway disease, at least one part of diagnosis is the infiltration of blood leukocytes, including eosinophils, neutrophils, lymphocytes, and macrophages in the lung [3]. The CD4+ Th2-type lymphocytes (Th2 cells) and other inflammatory leukocytes in airways mucosa secret a wide range of inflammatory mediators that participate both directly and indirectly in remodeling of the airway wall, excessive mucus secretion, airway obstruction, and finally airway hyperreactivity [46].

CXCL12 as a homeostatic CXC chemokine is widely expressed with a broad range of functions (from recruitment of mature B and T cells to migration of haematopoietic progenitor cells from the bone marrow). It is well documented that CXCL12 plays a wide variety of roles in two unrelated set of diseases such as human immunodeficiency virus (HIV) and cancer, because its known receptor (CXCR4) is a coreceptor used by HIV T-tropic strains, and it is also the most widely expressed chemokine receptor in many different types of cancers and asthma [7, 8]. “The SDF-1 gene is located on human chromosome 10q11.1 and SDF1-3′A polymorphism is a single nucleotide polymorphism (SNP) at position 801 relative to the start codon in the 3′ untranslated region involving a G > A transition in SDF-1. The A allele is probably a target of cis-acting factors, and it is assumed to upregulate the expression of SDF-1” [9]. This polymorphism is the best-studied polymorphism in CXCL12 gene [1].

The association between this polymorphism and a variety of diseases from lung and breast cancer, acute myeloid lymphoma, leukemia, and chronic myeloproliferative disease to viral infections such as acute hepatitis is well documented [1].

There are no reports describing any association between SDF-1α 3′A polymorphism and pathogenesis of asthma. Therefore, the authors of this study hypothesized that this polymorphism may play a critical role in development of asthma in Iranian population; thus, this study investigated the predicted role of the +801G/A polymorphism in pathogenesis and progression of asthma in Iranian population.

2. Material and Methods

2.1. Subjects

In this study, we recruited 162 unrelated asthmatic patients with a mean age of years (ranged between 15 and 79 years) using easy convenience method. Women being pregnant, patients having a history of inflammatory and infectious diseases rather than asthma, and patients with a history of cigarette smoking were excluded from the study. The occurrence of asthma was diagnosed by an expert infectious diseases specialist according to the American Thoracic Society (ATS) criteria. According to the clinical findings and history, patients were classified into 2 groups, that is, allergic and nonallergic groups. We also enrolled 189 genetically unrelated subjects having normal spirometric values and no respiratory symptoms which were matched for sex and similar ethnicity origin with the patients. The study protocol was approved by the ethical committee at our institution (Rafsanjan University of Medical Sciences), and written informed consent was obtained from all participants, either patients or controls, prior to sample collection. Some characteristics of the subjects are summarized in Table 1.

Table 1: Subjects characteristics.
2.2. DNA Extraction

Asthmatic and control subjects’ peripheral blood samples were collected on Ethylenediaminetetraacetic acid (EDTA) precoated tubes and subjected to genomic DNA extraction using a commercial kit (Bioneer, South Korea). The extracted DNA samples were then stored at −20°C for further use.

2.3. Polymorphism Detection

The CXCL12 gene polymorphism at the position +801 was analyzed by polymerase chain reaction-restriction length polymorphism (PCR-RFLP) method. As previously described by Hassanshahi et al., Azin et al., and Ryabov et al. [1012], a PCR reaction mixture was made up by addition of the following reagents to a 0.2 mL microcentrifuge tube on ice:

2.5 μL of taq DNA polymerase buffer (10X), 0.5 μL of MgCl2 (stock concentration 1.5 mM), 0.5 μL of each dNTP (dATP, dCTP, dGTP, and dTTP) stock concentration of 10 mM), 1 μL of each primer (forward: CAGTCAACCTGGGCAAAGCC and reverse: AGCTTTGGTCCTGAGAGTCC), stock concentration of 25 ng/μL, 1 μL of prepared DNA, and sterile double-distilled water to a final volume of 25 μL. The following program was used for fragment amplification: one cycle of 93°C for 2 min, 93°C for 1 min (denaturation), 1 min at 57°C for annealing of CXCL12, 72°C for 40 sec (elongation) followed by 30 cycles of 93°C for 20 sec, 55°C for 20 sec, and 72°C for 40 sec. Within the last 45 sec of the first stage, approximately 0.3 μL of Taq DNA polymerase was added to the mixture. The final volume was 20 μL which contains 2 μL of primer mix of forward and reverse, 10 μL of Master mix (dNTP, MgCl2, and Taq enzyme), 3 μL of DNA, and 5 μL of DNase-free water. The amplified PCR product of CXCL12 gene covers +801 regions with a molecular size of 302 bp. The Sac-1 (Fermentas, Lithuania) restriction enzyme has only one restriction site on this region, and is capable to digest the fragment and produce two fragments of 202 and 100bp following digestion. In fact, in case of heterozygotic form (A/G), 3 different fragments with 302, 202, and 100 bp are then visible, while in homozygotic form, a 302 bp fragment (without any digestion (A/A)) or two 202 and 100 bp (digesting both alleles (G/G)) was then observed (Table 2 and Figure 2). The digested products were electrophoresed on a 2.5% agarose gel following addition of 4 μL of loading buffer (Cinnagen, Iran) and studied on ChemiDoc model XRS (Bio-Rad, USA) subsequent to ethidium bromide staining.

Table 2: Frequency of polymorphisms of SDF-1α (CXCL12) gene in asthma patients and controls.
2.4. Chemokine Assay

The serum level of CXCL12 was measured by ELISA (R&D systems, UK) in patients and healthy controls immediately after blood collection. Assays were performed as per manufacturer’s guidelines. The sensitivity of kits was 2 pg/mL, and inter- and intra-assay assessments of reliability of the kit were conducted.

2.5. Statistical Analysis

Hardy-Weinberg equilibrium was assessed using genotype data. Allele and genotype frequencies were calculated in patients and healthy controls by direct gene counting. Statistical analysis of the differences between groups was determined by , t-test, and ANOVA using SPSS software version 17 which power of test was %90. value of less than 0.05 was considered significant.

3. Results

Statistical analysis of demographic parameters indicated that the mean age, gender, and socioeconomical status of the participants had no markedly differences, which were as follows: the mean age of patients was years and of control group was years ( ), and the gender variation of patients was 129 (56.58%) female and 99 (43.42%) male and for control group was 101 (61%) female and 88 (38.6%) male ( ) (Table 1).

Analysis of the polymorphisms in +801 of CXCL12 by Sac-1 restriction enzyme showed that the frequency of A/A genotype was 18 (4.3%) in patients and 27 (6.5%) in controls (OR = 2.541, 95% CI ). Our results also revealed that the frequency of A/G genotype was 190 (45.6%) and 60 (14.4%) in patients and controls, respectively (OR = 0.144, 95% ).

The frequency of the G/G genotype in patients was 20 (4.8%) and in controls was 102 (24.5%) (Table 2), where statistically analyzed data indicated a significant difference between the two groups ( ) (OR = 4.021, 95% CI = 2.21–7.29, ). The frequency of allele was 226 (27.1%) and 114 (13.7%) in patients and controls, respectively. In case of allele, 230 (27.6%) were observed in patients, while the frequency of this allele was 264 (31.7%) in controls (Table 2). Statistical analysis of alleles exhibited a significant difference between patients and controls ( ). The results of this study also showed that the plasma level of CXCL12 was and  pg/mL in asthma patients and healthy controls, respectively (Figure 1). Statistical analysis showed that the difference was significant ( ). Our results indicated that the protein levels of SDF-1 in AG genotype in asthma and control were and , respectively, which the difference was significant ( ). Analysis of our data showed that the protein levels of SDF-1 in AA genotype in asthma and control were and , respectively, which the difference was not significant ( ). Analysis of data by Eta test did not show significant difference between genotype and protein level of SDF-1 in patient group (approx. sig = 0.654, OR = 11.89/13.61); it also showed that there is no significant difference between FEV1 percent and genotype in patient group (Eta Test, approx. sig = 0.654, OR = 58.40/59.58) and that there is no significant difference between genotype and FEV1/FVC percent in patient group (Eta Test, approx. sig = 0.654, OR = 64.60/65.60). Analysis data by Spearman’s test (Spearman’s correlation coefficient) showed significant difference between protein level of SDF-1 and FEV1 percent and between protein level of SDF-1 and FEV1/FVC percent in patient group ( ); this is an inverse relationship between protein level of SDF-1 and FEV1 percent and between protein level of SDF-1 and FEV/FVC percent (Table 3).

Table 3: The results of analyzing data by Spearman's correlation coefficient test for relationship between protein level of SDF-1 and FEV1 percent (%) and between protein level of SDF-1 (pg/mL) and FEV/FVC (%) in patient group; significant difference ( ) and inverse relationship (correlation coefficient: −1.00) were observed.
Figure 1: SDF-1 (CXCL12) circulating level in asthma patients and controls. *= significant difference was observed in SDF-1 (CXCL12) serum level ( ). Data are shown as mean ± SEM.
Figure 2: Sac-1 digestion of PCR product of SDF-1 gene. Lane 1: heterozygotic digestion of PCR product of SDF-1 (A/G). Lane 2: homozygotic digestion (G/G). Lane 3: 100 bp ladder marker. Lane 4: homozygotic nondigested PCR product (A/A). bp = base pair.

Analysis data with Kruskal-Wallis Test (because this kind of data does not have normal distribution, we had to use this test to obtain mean rank of three genotype polymorphisms for protein level of SDF-1, FEV1 percent, and FEV1/FVC percent) showed that AA, AG, and GG genotypes have the mean rank of 71.38, 46.81, and 56.79 for the protein level of SDF-1, 32.63, 57.19, and 47.21 for the FEV1 percent and 32.63, 57.19, and 47.21 for the FEV1/FVC percent, respectively, in patient group. For all of them, , which showed significant difference ( ) for protein level of SDF-1, FEV1 percent, and FEV1/FVC percent (Table 4).

Table 4: The mean rank of AA, AG, and GG genotypes for the protein level SDF-1, FEV1 percent, and FEV1/FVC percent in patient group. These data were produced by the Kruskal-Wallis test. There is a significant difference in all of them ( in all).

4. Discussion

The current study was undertaken to investigate the role of CXCL12 + 801 G/A SNP polymorphism in susceptibility to asthma in Iranian asthma patients. All of study groups (patients and controls) had same ethnic background origin and shared a common geographic origin in Southeast part of Iran. We demonstrated a closed association between this polymorphism and asthma in Iranian asthma patients. To our best knowledge, this is the first study to report an association between this polymorphism and asthma. The paramount importance of chemokines and their receptors, as the central actors in the initiation and development of asthma, has been evidenced [13, 14]. Results of our study may confirm the role played by SDF-1α (CXCL12) angiogenic alterations associated with asthma which was reported by Hoshino et al., 2003 [15].

Hoshino et al. showed that immunoreactivity of CXCL12 is increased within the airways of asthmatic patients and reported that expression of CXCL12 plays an important role in angiogenesis in the airways of asthmatic patients [15].

The expanded vascularity that has been reported in the asthmatic mucosa might possibly confirm that angiogenesis is a component of the chronic inflammatory response in asthmatic patients, and increased CXCL12 circulatory level in asthmatics may confirm that angiogenesis is a specific characteristic of asthma, which is probably at least partially mediated by CXCL12 [1618].

However, angiogenesis function of chemokines is currently the focus of intense investigations; little information is known on the roles of chemokines in pathological remodeling of the asthmatic airway. Mice lacking the CXCL12 gene have defective vascular development, suggesting that CXCL12 plays an important role in organ vascularisation [19]. Recent studies have demonstrated that endothelial cells are strongly chemoattracted to CXCL12 [2022]. Cytokine-mediated regulation of CXCL12 has been demonstrated in eosinophils and lung epithelial cells [23, 24]; the effects of CXCL12/CXCR4 axis showed a contribution to the inflammatory response in a murine model of asthma [25]. Because CXCL12 is a potent chemotactic factor for T and pre-B lymphocytes [26, 27], plasma cells [28], and dendritic cells (DCs) [29] and expression of SDF-1 (CXCL12) receptor (CXCR4) is also documented on eosinophils [24, 30] and mast cells [31–33] - the two critical components in allergic conjunctivitis [33]. It may facilitate infiltration of these cell types to the lung vascular system. CXCL12 may also recruit a wide variety of mature and immature CXCR4 positive leukocytes to the lungs and stimulate neovascularization [34]. CXCR4 and CXCL12 are considered to be essential factors of allergic airway disease in the mouse [25, 35] and humans [36]. Thus, the increased circulating level of these chemokines that we have shown in our study may contribute to the process of recruitment of these cell types to the asthmatics’ lungs. On the other side, the defective myelopoiesis and lymphopoiesis in parallel with lack of cardiovascular development in CXCL12 or CXCR4 (its receptor) may prove its role in homeostasis roles rather than inflammatory properties [19, 37, 38]; thus, increased circulatory level of CXCL12 in our asthma patients may be related to its role in remodeling of airways as an homeostatic chemokine rather than its other roles. Although previous reports indicated that the A allele is associated with higher CXCL12 expression [39], further studies pointed to the opposite side [40], and few studies claimed that there were no differences in the CXCL12 production by the A or G alleles [41, 42]. A more recent haplotype-based investigation [43] demonstrated that other polymorphisms in LD with the CXCL12 + 801G/A SNP, rather than the CXCL12 + 801G/A, are involved in control of the different transcription levels of CXCL12. Although the role of autoimmunity is not that much clear in the pathogenesis of asthma, SDF1-3′ G801A polymorphisms in Polish patients with systemic lupus erythematous which follow an autoimmune pattern are documented by Warchoł et al. [44]. As far as we sought to obtain more related studies in relation of asthma with this polymorphism we were unable but our studies on multiple sclerosis (Azin et al., [11]) and also unpublished data in type 1 diabetes as the two important diseases which similarly as asthma follow the pattern of autoimmunity revealed a close relation between autoimmunity and this polymorphism. Hence, there may possibly be an association between autoimmunity and the SDF-1α 3′A polymorphism that presents in autoimmune disorders.

Nevertheless, our study was affected by some limitations. It should be considered that all of our study population (both control and asthma patients) were within Iranian population, and thus, the possibility of ethnicity as a confining factor could be excluded. However, it should be noted that different geographical and ethnic backgrounds of the individuals can influence the consequences of the association studies. Therefore, findings of the current study need to be examined and confirmed in other populations and ethnic groups. Moreover, further replication studies using a wider sample size and different population would be essential for further evaluation of the relationship between the CXCL12 genetic variations and the risk of asthma.

Conflict of Interests

All of authors of this paper declare that there are no competing financial interests in relation to this work. Furthermore, none of the authors have a relationship with any factory or company for financial support.


Authors of this paper thank all of asthmatic patients and healthy controls. This project is financially supported by a grant from Rafsanjan University of Medical Sciences.


  1. R. Colobran, R. Pujol-Borrell, M. P. Armengol, and M. Juan, “The chemokine network. II. On how polymorphisms and alternative splicing increase the number of molecular species and configure intricate patterns of disease susceptibility,” Clinical and Experimental Immunology, vol. 150, no. 1, pp. 1–12, 2007. View at Publisher · View at Google Scholar · View at Scopus
  2. A. Sandford, T. Weir, and P. Paré, “The genetics of asthma,” American Journal of Respiratory and Critical Care Medicine, vol. 153, no. 6, part 1, pp. 1749–1765, 1996. View at Google Scholar · View at Scopus
  3. W. W. Busse and R. F. Lemanske Jr., “Asthma,” The New England Journal of Medicine, vol. 344, no. 5, pp. 350–362, 2001. View at Publisher · View at Google Scholar · View at Scopus
  4. D. S. Robinson, Q. Hamid, M. Jacobson, S. Ying, A. B. Kay, and S. R. Durham, “Evidence for Th2-type T helper cell control of allergic disease in vivo,” Springer Seminars in Immunopathology, vol. 15, no. 1, pp. 17–27, 1993. View at Google Scholar · View at Scopus
  5. M.-C. Seminario and G. J. Gleich, “The role of eosinophils in the pathogenesis of asthma,” Current Opinion in Immunology, vol. 6, no. 6, pp. 860–864, 1994. View at Publisher · View at Google Scholar · View at Scopus
  6. N. A. Lee, E. W. Gelfand, and J. J. Lee, “Pulmonary T cells and eosinophils: coconspirators or independent triggers of allergic respiratory pathology?” Journal of Allergy and Clinical Immunology, vol. 107, no. 6, pp. 945–957, 2001. View at Publisher · View at Google Scholar · View at Scopus
  7. A. Zlotnik, “Chemokines and cancer,” International Journal of Cancer, vol. 119, no. 9, pp. 2026–2029, 2006. View at Publisher · View at Google Scholar · View at Scopus
  8. M. C. Negrete-García, J. R. Velazquez, A. Popoca-Coyotl, A. R. Montes-Vizuet, E. Juárez-Carvajal, and L. M. Teran, “Chemokine(C-X-C motif) ligand 12/stromal cell-derived factor-1 is associated with leukocyte recruitment in asthma,” Chest, vol. 138, no. 1, pp. 100–106, 2010. View at Publisher · View at Google Scholar · View at Scopus
  9. B. Luan, Y. Han, X. Zhang, J. Kang, and C. Yan, “Association of the SDF1-3′A polymorphism with susceptibility to myocardial infarction in Chinese Han population,” Molecular Biology Reports, vol. 37, no. 1, pp. 399–403, 2010. View at Publisher · View at Google Scholar · View at Scopus
  10. G. Hassanshahi, M. K. Arababadi, H. Khoramdelazad, N. Yaghini, and E. R. Zarandi, “Assessment of CXCL12 (SDF-1α) polymorphisms and its serum level in posttransfusion occult HBV-infected Patients in Southeastern Iran,” Archives of Medical Research, vol. 41, no. 5, pp. 338–342, 2010. View at Publisher · View at Google Scholar · View at Scopus
  11. H. Azin, R. Vazirinejad, B. N. Ahmadabadi et al., “The SDF-1 3′A genetic variation of the chemokine SDF-1alpha (CXCL12) in parallel with its increased circulating levels is associated with susceptibility to MS: a study on iranian multiple sclerosis patients,” Journal of Molecular Neuroscience, pp. 1–6, 2011. View at Publisher · View at Google Scholar · View at Scopus
  12. G. S. Ryabov, E. V. Kazennova, M. R. Bobkova, and A. F. Bobkov, “Prevalence of alleles associated with HIV resistance in Russia,” Genetic Testing, vol. 8, no. 1, pp. 73–76, 2004. View at Publisher · View at Google Scholar · View at Scopus
  13. A. Heinzmann, I. Ahlert, T. Kurz, R. Berner, and K. A. Deichmann, “Association study suggests opposite effects of polymorphisms within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis,” Journal of Allergy and Clinical Immunology, vol. 114, no. 3, pp. 671–676, 2004. View at Publisher · View at Google Scholar · View at Scopus
  14. B. Puthothu, M. Krueger, J. Heinze, J. Forster, and A. Heinzmann, “Impact of IL8 and IL8-Receptor alpha polymorphisms on the genetics of bronchial asthma and severe RSV infections,” Clinical and Molecular Allergy, vol. 4, no. 2, p. 2, 2006. View at Publisher · View at Google Scholar · View at Scopus
  15. M. Hoshino, N. Aoike, M. Takahashi, Y. Nakamura, and T. Nakagawa, “Increased immunoreactivity of stromal cell-derived factor-1 and angiogenesis in asthma,” European Respiratory Journal, vol. 21, no. 5, pp. 804–809, 2003. View at Publisher · View at Google Scholar · View at Scopus
  16. X. Li and J. W. Wilson, “Increased vascularity of the bronchial mucosa in mild asthma,” American Journal of Respiratory and Critical Care Medicine, vol. 156, no. 1, pp. 229–233, 1997. View at Google Scholar · View at Scopus
  17. B. E. Orsida, X. Li, B. Hickey, F. Thien, J. W. Wilson, and E. H. Walters, “Vascularity in asthmatic airways: relation to inhaled steroid dose,” Thorax, vol. 54, no. 4, pp. 289–295, 1999. View at Google Scholar · View at Scopus
  18. G. Salvato, “Quantitative and morphological analysis of the vascular bed in bronchial biopsy specimens from asthmatic and non-asthmatic subjects,” Thorax, vol. 56, no. 12, pp. 902–906, 2001. View at Publisher · View at Google Scholar · View at Scopus
  19. K. Tachibana, S. Hirota, H. Iizasa et al., “The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract,” Nature, vol. 393, no. 6685, pp. 591–594, 1998. View at Publisher · View at Google Scholar · View at Scopus
  20. S. K. Gupta, P. G. Lysko, K. Pillarisetti, E. Ohlstein, and J. M. Stadel, “Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines,” Journal of Biological Chemistry, vol. 273, no. 7, pp. 4282–4287, 1998. View at Publisher · View at Google Scholar · View at Scopus
  21. C. Feil and H. G. Augustin, “Endothelial cells differentially express functional CXC-chemokine receptor-4 (CXCR-4/fusin) under the control of autocrine activity and exogenous cytokines,” Biochemical and Biophysical Research Communications, vol. 247, no. 1, pp. 38–45, 1998. View at Publisher · View at Google Scholar · View at Scopus
  22. M. V. Volin, L. Joseph, M. S. Shockley, and P. F. Davies, “Chemokine receptor CXCR4 expression in endothelium,” Biochemical and Biophysical Research Communications, vol. 242, no. 1, pp. 46–53, 1998. View at Publisher · View at Google Scholar · View at Scopus
  23. J. Eddleston, S. C. Christiansen, and B. L. Zuraw, “Functional expression of the C-X-C chemokine receptor CXCR4 by human bronchial epithelial cells: regulation by proinflammatory mediators,” Journal of Immunology, vol. 169, no. 11, pp. 6445–6451, 2002. View at Google Scholar · View at Scopus
  24. H. Nagase, M. Miyamasu, M. Yamaguchi et al., “Expression of CXCR4 in eosinophils: functional analyses and cytokine- mediated regulation,” Journal of Immunology, vol. 164, no. 11, pp. 5935–5943, 2000. View at Google Scholar · View at Scopus
  25. J.-A. Gonzalo, C. M. Lloyd, A. Peled, T. Delaney, A. J. Coyle, and J.-C. Gutierrez-Ramos, “Critical involvement of the chemotactic axis CXCR4/stromal cell-derived factor-1α in the inflammatory component of allergic airway disease,” Journal of Immunology, vol. 165, no. 1, pp. 499–508, 2000. View at Google Scholar · View at Scopus
  26. C. C. Bleul, R. C. Fuhlbrigge, J. M. Casasnovas, A. Aiuti, and T. A. Springer, “A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1),” Journal of Experimental Medicine, vol. 184, no. 3, pp. 1101–1109, 1996. View at Google Scholar · View at Scopus
  27. M. D'Apuzzo, A. Rolink, M. Loetscher et al., “The chemokine SDF-1, stromal cell-derived factor 1, attracts early stage B cell precursors via the chemokine receptor CXCR4,” European Journal of Immunology, vol. 27, no. 7, pp. 1788–1793, 1997. View at Publisher · View at Google Scholar · View at Scopus
  28. D. C. Hargreaves, P. L. Hyman, T. T. Lu et al., “A coordinated change in chemokine responsiveness guides plasma cell movements,” Journal of Experimental Medicine, vol. 194, no. 1, pp. 45–56, 2001. View at Publisher · View at Google Scholar · View at Scopus
  29. S. Sozzani, W. Luini, A. Borsatti et al., “Receptor expression and responsiveness of human dendritic cells to a defined set of CC and CXC chemokines,” Journal of Immunology, vol. 159, no. 4, pp. 1993–2000, 1997. View at Google Scholar · View at Scopus
  30. H. Nagase, K. Kudo, S. Izumi et al., “Chemokine receptor expression profile of eosinophils at inflamed tissue sites: decreased CCR3 and increased CXCR4 expression by lung eosinophils,” Journal of Allergy and Clinical Immunology, vol. 108, no. 4, pp. 563–569, 2001. View at Publisher · View at Google Scholar · View at Scopus
  31. M. Juremalm, M. Hjertson, N. Olsson, I. Harvima, K. Nilsson, and G. Nilsson, “The chemokine receptor CXCR4 is expressed within the mast cell lineage and its ligand stromal cell-derived factor-1alpha acts as a mast cell chemotaxin,” European Journal of Immunology, vol. 30, no. 12, pp. 3614–3622, 2000. View at Google Scholar
  32. T.-J. Lin, T. B. Issekutz, and J. S. Marshall, “SDF-1 induces IL-8 production and transendothelial migration of human cord blood-derived mast cells,” International Archives of Allergy and Immunology, vol. 124, no. 1–3, pp. 142–145, 2001. View at Publisher · View at Google Scholar · View at Scopus
  33. A. Leonardi, “The central role of conjunctival mast cells in the pathogenesis of ocular allergy,” Current Allergy and Asthma Reports, vol. 2, no. 4, pp. 325–331, 2002. View at Google Scholar · View at Scopus
  34. A. Leonardi, “Vernal keratoconjunctivitis: pathogenesis and treatment,” Progress in Retinal and Eye Research, vol. 21, no. 3, pp. 319–339, 2002. View at Publisher · View at Google Scholar · View at Scopus
  35. N. W. Lukacs, A. Berlin, D. Schols, R. T. Skerlj, and G. J. Bridger, “AMD3100, a CxCR4 antagonist, attenuates allergic lung inflammation and airway hyperreactivity,” American Journal of Pathology, vol. 160, no. 4, pp. 1353–1360, 2002. View at Google Scholar · View at Scopus
  36. S. D. Trocmé, C. K. Hallberg, K. S. Gill, G. J. Gleich, S. K. Tyring, and M. M. Brysk, “Effects of eosinophil granule proteins on human corneal epithelial cell viability and morphology,” Investigative Ophthalmology & Visual Science, vol. 38, no. 3, pp. 593–599, 1997. View at Google Scholar
  37. Y.-R. Zou, A. H. Kottman, M. Kuroda, I. Taniuchi, and D. R. Littman, “Function of the chemokine receptor CXCR4 in heaematopolesis and in cerebellar development,” Nature, vol. 393, no. 6685, pp. 595–599, 1998. View at Publisher · View at Google Scholar · View at Scopus
  38. T. Nagasawa, S. Hirota, K. Tachibana et al., “Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1,” Nature, vol. 382, no. 6592, pp. 635–638, 1996. View at Publisher · View at Google Scholar · View at Scopus
  39. C. Winkler, W. Modi, M. W. Smith et al., “Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant. ALIVE Study, Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC),” Science, vol. 279, no. 5349, pp. 389–393, 1998. View at Google Scholar
  40. A. Soriano, C. Martínez, F. García et al., “Plasma stromal cell-derived factor (SDF)-1 levels, SDF1-3′A genotype, and expression of CXCR4 on T lymphocytes: their impact on resistance to human immunodeficiency virus type 1 infection and its progression,” Journal of Infectious Diseases, vol. 186, no. 7, pp. 922–931, 2002. View at Publisher · View at Google Scholar · View at Scopus
  41. S. K. Arya, C. C. Ginsberg, A. Davis-Warren, and J. D'Costa, “In vitro phenotype of SDF1 gene mutant that delays the onset of human immunodeficiency virus disease in vivo,” Journal of Human Virology, vol. 2, no. 3, pp. 133–138, 1999. View at Google Scholar · View at Scopus
  42. R. Kimura, T. Nishioka, and T. Ishida, “The SDF1-G801A polymorphism is not associated with SDF1 gene expression in Epstein-Barr virus-transformed lymphoblastoid cells,” Genes and Immunity, vol. 4, no. 5, pp. 356–361, 2003. View at Publisher · View at Google Scholar · View at Scopus
  43. R. Kimura, T. Nishioka, A. Soemantri, and T. Ishida, “Allele-specific transcript quantification detects haplotypic variation in the levels of the SDF-1 transcripts,” Human Molecular Genetics, vol. 14, no. 12, pp. 1579–1585, 2005. View at Publisher · View at Google Scholar · View at Scopus
  44. T. Warchoł, M. Lianeri, J. K. Łacki, and P. P. Jagodziński, “SDF1-3′ G801A polymorphisms in Polish patients with systemic lupus erythematosus,” Molecular Biology Reports, vol. 37, no. 7, pp. 3121–3125, 2010. View at Publisher · View at Google Scholar · View at Scopus