Research Article
Responses of Growth Performance and Proinflammatory Cytokines Expression to Fish Oil Supplementation in Lactation Sows’ and/or Weaned Piglets’ Diets
Table 2
Oligonucleotide polymerase chain reaction primers.
| | Gene1 | Accession no. | Primer source | Primer sequences () | Orientation | Product size, bp | (°C) |
| | IL-1β | M86725 | Pig | ATTCGAGTCTGCCCTGTA | Forward | 147 | 54 | | TCTGGGTATGGCTTTCCT | Reverse | | IL-6 | M80258 | Pig | GCATTCCCTCCTCTGGTC | Forward | 93 | 58 | | ATAGTGTCCTAACGCTCAT | Reverse | | TNF-α | AY572787 | Pig | CTCCCTCTTTGTCTCCTCC | Forward | 77 | 54 | | GCATTGGCATACCCACTCT | Reverse | | -actin | SSU07786 | Pig | GGACTTCGAGCAGGAGATGG | Forward | 233 | — | | GCACCGTGTTGGCGTAGAGG | Reverse |
|
|
IL-1β: interleukin 1, IL-6: interleukin 6, TNF-α: tumor necrosis factor-α. : optimal PCR annealing temperature.
|