BioMed Research International / 2014 / Article / Tab 1

Research Article

Recombinant nAG (a Salamander-Derived Protein) Decreases the Formation of Hypertrophic Scarring in the Rabbit Ear Model

Table 1

Primers and probes used for real-time PCR.

GeneGene accession numberPrimer and probe sequenceAmplicon size (bp)

Rab. COL1 F.P.NM_001195668 XM_002713800CCCAACCAAGGATGCACTAT126
Rab. COL1 Probe5′-FAM, TCTCTACTGGCGAAACCTGCATCC, BHQ1-3′
Rab. COL1 R.P.CTTGGCCTTGGAGCTCTTATAC

Rab. COL3 F.P.S83371.1CATTGGCCCTGTTTGCTTT110
Rab. COL3 Probe5′-FAM, AAACCAACCTCTTCCTGAAGCCC, BHQ1-3′
Rab. COL3 R.P.CACTTGTACTGGTTGACAAGATTAG

Rab. MMP1 F.P.NM_001171139GCAGAATGAGCTACCAGGATAC89
Rab. MMP1 Probe5′-FAM, AGGACATTCACAGCTCCTTTGGCT, BHQ1-3′
Rab. MMP1 R.P.CAGAAACAGCAGCGTCAATATG

Rab. GAPDH F.P.NM_001082253.1ATGGCCTCCAAGGAGTAAGA149
Rab. GAPDH Probe5′-HEX, CAGTCCCACCACGCTGAGAATCTG, BHQ1-3′
Rab. GAPDH R.P.CTGGGATGGAAACTGTGAAGAG