BioMed Research International / 2014 / Article / Tab 1

Research Article

CpG Island Methylator Phenotype and Prognosis of Colorectal Cancer in Northeast China

Table 1

HRM primers and amplicon information.

Gene namePrimer sequences 5′-3′GenBankNumber of CpG-sites/length
Accession numberof amplified fragment

MGMT Fw GCGTTTCGGATATGTTGGGATAGT
Rv AACGACCCAAACACTCACCAAA
X6165715/110

MLH1 Fw TTTTTTTAGGAGTGAAGGAGG
Rv AACRCCACTACRAAACTAAA
AY21754913/123

APC Fw AAGTAGTTGTGTAATTCGTTGGAT
Rv CACCTCCATTCTATCTCCAATA
NT_03477211/149

p16 Fw GGAGTTTTCGGTTGATTGGTTGGTT
Rv AACAACGCCCGCACCTCCTCTA
AF5278035/69

MINT1 Fw GGGGTTGAGGTTTTTTGTTAG
Rv AATCCCTCTCCCCTCTAAACTT
AF1355017/137

MINT31 Fw GGGTGATGGTTTTAGTAAAGTGAG
Rv AAAAACACTTCCCCAACATCTAC
AF13553110/164

RUNX3 Fw TTTTTAGAGAATGAGGGATTTTTGT
Rv CCCTAATCCCTTAAATCTAATACCC
NC_0000017/115

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.