Research Article
Detection of Herpes Simplex and Varicella-Zoster Virus in Clinical Specimens by Multiplex Real-Time PCR and Melting Curve Analysis
Table 1
Primer sequences used and product sizes of each target genes for HSV-1, HSV-2, VZV, and HERV-3.
| Virus | Gene target | Primer sequences (5′→3′) | Amplicon (bp) | Reference |
| HSV-1 | gpD | Forward primer: GGTCTCTTTTGTGTGGTGC | 84 | This study | Reverse primer: GCCCACTATGACGACAAAC | This study |
| HSV-2 | gpG | Forward primer: TACGCTCTCGTAAATGCTTC | 120 | This study | Reverse primer: GCCCACCTCTACCCACAA | This study |
| VZV | ORF4 | Forward primer: GCCCATGAATCACCCTC | 79 | This study | Reverse primer: ACTCGGTACGCCATTTAG | This study |
| HERV-3 | envelope | Forward primer: CATGGGAAGCAAGGGAACTAATG | 135 | Yuan et al., 2001 [7] | Reverse primer: CCCAGCGAGCAATACAGAATTT | Yuan et al., 2001 [7] |
|
|
HSV: herpes simplex virus; VZV: varicella-zoster virus; HERV-3: human endogenous retrovirus; gpD: glycoprotein D; gpG: glycoprotein G; ORF4: open reading frame 4.
|