BioMed Research International / 2014 / Article / Tab 1

Research Article

Expression of Acetylcholine Receptors by Experimental Rat Renal Allografts

Table 1

Primer sequences used for real-time PCR.

GeneAccession numberDirection 5′-3′ sequenceProduct (bp)

CHRM1NM_080773Forward tgtggccagcaacgcctctg106
Reverseccttcggggagtgcgcttgg

CHRM2NM_031016Forward gcccaacccaccacgagcc102
Reverseagttgtggccgctgcggaa

CHRM3NM_012527Forward gtccctcggaggcagggct116
Reverseacccccgagagggtcgctg

CHRM4NM_031547Forward cgactcgcggaacctctggc117
Reverseggcgtgaagttggccatgctg

CHRM5NM_017362Forward ccacagcaaagtcgatgaggca102
Reversetttggcctcccctcttcttggc

CHRNA2NM_133420Forward cacggccagtgcccaacact119
Reversectgctttagccagacattggtggt

CHRNA3NM_052805Forward tgggtgttgtgctgctcccg124
Reverseactggaacaggcggtgctca

CHRNA4NM_024354Forward agggaccggcctcttgcctg113
Reversetgcctactggccgagaccac

CHRNA5NM_017078Forward accagctgatgacgacgaacg117
Reverseacagggagtccgaaggaacacg

CHRNA6NM_057184Forward ctttgagttggccatcacgc116
Reverseccgttggatcccaacacaatc

CHRNA7NM_000746.4Forward agatggccagatttggaaacc142
Reversegcaggaactcttgaatatgcct

CHRNA9NM_022930Forward atctggtgtggaggccggaca119
Reverseggccggtgagtcccaggtgat

CHRNA10NM_022639Forward accagtggcagatacagaccagac124
Reversetgtccactcttgccggatccac

CHRNB2NM_019297Forward gtccggctcccttccaaacaca114
Reversegctgccatcataggagaccacagc

CHRNB4NM_052806Forward ccgcctggagctatcactgtcc110
Reversetccaggccaggcggtagtca

PBGDNM_013168Forward ggcgcagctacagagaaagt115
Reverseagccaggataatggcactga