Table 1: PCR primers used to produce three overlapping segments of CA XII.

Segment numberSegment sequencePCR primer sequences*Restriction endonuclease

#1Val 27-Gly1305′ CCCGGGATCCGTGAACGGTTCCAAG 3′BamHI
5′ ACGGCGGCCGCTTAGCCGTGCGGGTCATT 3′NotI

#2Ser111-Leu2105′ GGGCGGATCCTCTCGCTACAGTGCC 3′BamHI
5′ GTCCTCTCGAGTTACAGCTCTTCAATGTTG 3′XhoI

#3Asp184-Ser2905′ TCCGGGATCCGACAAGATCTTCAGTC 3′BamHI
5′ AGACCTCGAGTTAGGAGAAGGAGGTGTATAC 3′XhoI

Restriction endonuclease recognition sites are underlined.