Table 2: Primers used in PCR1 and PCR2.

Sequence (5′ to 3′)LocationLength (bp)Product size (bp) (°C)

Primers for PCR1
381 & 861
 Com (F)GCCCAGGAGTTAGAGGCAACATAAC257–28125106066.2
 Com (R)CAGCTTTCTCTGATCTCCTGGTGTG1316–12922566.2
5808
 Com (F)ATTCTGGAGTCTGGGATCGGTGTG5546–55692439866.3
 Com (R)ACCCCAGAATCTCCAGCTCCCTG5943–59212368.1
9041
 Com (F)CAGCTCCTGGCATCTAGGTAGTGC8604–86272485368.0
 Com (R)CTTCCAGGTGTGTGCTCAGCCTTC9456–94332468.0
Primers for PCR2
381
 381 & 861 Com (R)CAGCTTTCTCTGATCTCCTGGTGTG1316–12922566.2
 WT (F)AGCACTTTAGGAAGCCAAGGAGGGC357–3812596067.9
 Mut (F)AGCACTTTAGGAAGCCAAGGAGGGT357–3812596066.2
861
 381 & 861 Com (R)CAGCTTTCTCTGATCTCCTGGTGTG1316–12922566.2
 WT (F)AAACTCCTGACCTCAGGTGATCCAC837–8612548066.2
 Mut (F)AAACTCCTGACCTCAGGTGATCCAA837–8612548064.6
5808
 Com (F)ATTCTGGAGTCTGGGATCGGTGTG5546–55692466.3
 WT (R)CGCCAACACCCCCCTTCA5825–58081828071.7
 Mut (R)CGCCAACACCCCCCTTCC5825–58081828070.8
9041
 Com (R)CTTCCAGGTGTGTGCTCAGCCTTC9456–94332468.0
 WT (F)CCTCCTCCTGCCATACCCG9023–90411943466.6
 Mut (F)CCTCCTCCTGCCATACCCA9023–90411943464.5